- Research
- Open access
- Published:
The Mediator Subunit OsMED16 Interacts with the WRKY Transcription Factor OsWRKY45 to Enhance Rice Resistance Against Magnaporthe oryzae
Rice volume 17, Article number: 23 (2024)
Abstract
Rice blast, caused by Magnaporthe oryzae (M. oryzae), is one of the most common and damaging diseases of rice that limits rice yield and quality. The mediator complex plays a vital role in promoting transcription by bridging specific transcription factors and RNA polymerase II. Here, we show that the rice mediator subunit OsMED16 is essential for full induction of the diterpenoid phytoalexin biosynthesis genes and resistance to the ascomycetous fungus M. oryzae. Mutants of Osmed16 show reduced expression of the DP biosynthesis genes and are markedly more susceptible to M. oryzae, while transgenic plants overexpressing OsMED16 increased the expression of the DP biosynthesis genes and significantly enhanced resistance to M. oryzae. Interestingly, OsMED16 is physically associated with the WRKY family transcription factor OsWRKY45, which interacts with the phytoalexin synthesis key regulator transcription factor OsWRKY62. Further, OsMED16-OsWRKY45-OsWRKY62 complex could bind to the promoter regions of phytoalexin synthesis-related genes and activate their gene expression. Our results show that OsMED16 may enhance rice tolerance to M. oryzae via directly manipulating phytoalexin de novo biosynthesis.
Background
Rice blast, caused by the fungal pathogen M. oryzae, is considered one of the most destructive diseases of cultivated rice and causes an average annual loss of rice yield of up to 20% (Saleh et al. 2014). The cultivation of resistant varieties is the most practical and cost-effective way to protect against rice blast. However, due to the diversity and rapid variation of M. oryzae, the resistance of rice varieties often decreases or loses after several years of application. Therefore, the continuous exploration of rice blast resistance genes will provide theoretical guidance and germplasm resources for rice blast resistance breeding, which is essential for safe rice production.
Phytoalexin are low-molecular-weight pathogen-resistant compounds that are synthesized endogenously in plants after pathogen infection (Paxton 1980). Diterpenoid phytoalexin (DP) has been discovered in a variety of dicots, including elm trees (Ulmus americana), cotton (Gossypium hirsutum), tobacco (Nicotiana tabacum), sweet potatoes (Ipomoea batatas) (Schmelz et al. 2014) and so on. Diterpenoids members currently identified in rice include oryzalexins A–F (Tadami et al. 1985; Sekido et al. 1986; Hideki et al. 1993; Kato et al. 1994), momilactones A and B (Cartwright et al. 1981), phytocassanes A–E (KOGA et al. 1995, 1997), oryzalexin S (Kodama et al. 1992) and ent-10-oxodepressin (Inoue et al. 2013). Phytoalexins are considered to have a crucial role in plant defense mechanisms and serve as molecular markers of plant resistance to disease. Several plants produced a variety of phytoalexins for responding to pathogenic infections (Ahuja et al. 2012). In rice, the antifungal activity against M. oryzae is a very significant biological activity of phytoalexins. The stockpile of phytoalexins has occurred quickly in rice after infestation by the M. oryzae (Ahuja et al. 2012; Schmelz et al. 2014). Moreover, exogenous momilactones A and B and ent-10-oxodepressin were found to have an inhibitory effect on the growth of M. oryzae (Cartwright et al. 1977; Inoue et al. 2013).
The synthesis-related genes of diterpenoid phytoalexin have been extensively reported (Yamane et al. 2013). Cytochromes P450 monooxygenases (CYP99A2, CYP99A3), copalyl diphosphate synthase (CPS3, CPS4), momilactone A synthase (MAS, MAS1), and kaurene synthase-like (KSL2, KSL3, KSL7, KSL10) (Shimono et al. 2007), have been shown to be involved in the momilactones biosynthesis. Moreover, the ent-kaurene oxidase paralogs (KOL1, KOL4, KOL5) were reported to contribute to participated in the oryzalexins A–C and E and phytocassanes A–E biosynthesis (Wang et al. 2012). CYP71Z7, CYP76M7 and CYP76M8 (Cho et al. 2004; Swaminathan et al. 2009; Wu et al. 2011) were shown to participate in the phytocassanes A–E biosynthesis.
In rice, the expression of DP biosynthesis genes were regulated in a OsWRKY45-dependent manner. More diterpenoid phytoalexin were synthesized in OsWRKY45 overexpression plants after M. oryzae infection (Akagi et al. 2014). The transcription factor of a basic helix-loop-helix (bHLH)-type named the diterpenoid phytoalexin factor (DPF) has been identified in rice, which is induced by M. oryzae and regulates the expression of diterpenoid phytoalexin biosynthetic genes (Yamamura et al. 2015). OsWRKY62 is a group IIa WRKY transcription factor, and the transcription of OsWRKY62 is regulated directly or indirectly by OsWRKY45. OsWRKY62 and OsWRKY45 transcriptions are simultaneously upregulated during benzothiadiazole (BTH) treatment and M. oryzae infection (Nakayama et al. 2013). OsWRKY62 acts as a positive defense regulator to activate the transcription of OsDPF genes (a transcription factor regulating diterpenoid phytoalexin biosynthetic genes) when it forms a heterotrimeric complex with the OsWRKY45 (Fukushima et al. 2016). However, whether and how OsWRKY45 cooperates with the mediator complex to activate diterpenoid phytoalexin synthesis genes remains unclear.
When plants are infected with pathogens, the balance of plant development and immunity is disrupted, and the organism will undergo a series of transcriptional reprogramming to activate defense-related gene expression (Katagiri 2004), The mediator complex, a conserved functional multiple protein complex, plays an important role to recruit RNA Pol II and particular transcription factors. The mediator has been widely studied in yeast and multicellular animals, but relatively delayed in plants (Bckstrm et al. 2007; Mathur et al. 2011; Ren et al. 2020; Hu et al. 2021a, b). Some mediator subunits have been found to be involved in immune resistance to various plant pathogens. AtMED25 act as a positive regulator in JA/ET signaling by interacting with MYC2 and COI1 in Arabidopsis to activate plant resistance against A. brassicicola and B. cinerea (Kidd et al. 2009; Cevik et al. 2012). AtMED14 positively regulates SA responsiveness and AtMED14 mutants show suppressed PR1 expression and reduced immune resistance to the Pseudomonas syringae (Canet et al. 2012; Zhang et al. 2013).
MED16, one of the tail subunits of the mediator, is widely involved in a variety of biological regulation, including flowering time, organ growth and development, and defense against a variety of biotic and abiotic stresses (Zhang et al. 2012; Wang et al. 2016; Dolan et al. 2017). The Arabidopsis MED16 both controls SA- and JA-mediated defense gene expression and plant immunity to Pseudomonas syringae (Zhang et al. 2012). It has been found that the overexpression of OsSFR6 (OsMED16 3513 bp) in the atsfr6 mutant background restored the visible phenotype of smaller plants of the wild type and restored the expression level of the wild-type COR gene and tolerance to osmotic stress and freezing stress (Wathugala et al. 2011). In rice, Zhang et al. found that VIGS silenced OsMED16 plants were more susceptible to rice blast disease (Zhang et al. 2021). Overexpression of OsMED16 (3906 bp) resulted in growth inhibition, yield reduction and the appearance of lesion mimic phenotype. RNA-Seq analysis showed that overexpression of OsMED16 resulted in the up-regulation of a large number of disease resistance-related genes (Jiang et al. 2021). However, recently a study has shown that overexpression of OsMED16 (3906) in japonica rice Zhonghua 11 “ZH11” did not exhibit lesion mimic phenotype and showed more susceptibility to rice blast (Zhang et al. 2023). In our study, using overexpression and gene knockout methods, we found that OsMED16 plays an important role in the expression of DP biosynthesis genes and rice blast tolerance. Further biochemical analyzes were performed to explore how OsMED16 cooperates with OsWRKY45-OsWRKY62 to synthetically activate DP biosynthesis genes Transcription.
Results
OsMED16 Positively Regulates Rice Resistance Against M. oryzae
Because the MED is widely associated with plant immune regulation, the tail subunits play an essential role in the recruitment of specific transcription factors to the target promoter regions (Zhang et al. 2012; Liu et al. 2019). Further, we cloned the full-length CDS of the OsMED16 (or named OsSFR6, which was reported by Wathugala et al. (2011)) from Wild-Type Nipponbare rice, which consists of 3513 nucleotides and encodes a protein of 1170 amino acids, 393 bp shorter than the version in the Rice Genome Annotation Project database. The phylogenetic analysis of the sequence of the protein revealed that the homologous sequence of OsMED16 was closest to BdMED16 (Brachypodium distachyon), followed by the MED16 protein from maize (Additional file 1: Fig. S2).
To verify whether OsMED16 modulates rice immunity to pathogens, two independent transgenic OsMED16 constitutively over-expression lines (OE-12 and OE-16) and two independent CRISPR/Cas9 knock-out lines (med16-11 and med16-26) were inoculated with M. oryzae isolate Guy11 in the laboratory. As previously reported (Jiang et al. 2021), the CRISPR/Cas9-edited OsMED16 orthologous plants grew extremely weakly at the seedling stage and failed to complete the fertility cycle (Additional file 1: Fig. S1). Interestingly, we found that lethality did not occur when one strand of the Med16 gene was effectively edited (med16-11 and med16-26, Fig. 1B), while RT-qPCR assays showed that the expression level of OsMED16 in med16-11 and med16-26 was lower than that of the wild type (Fig. 1A). The results of Guy11 inoculation indicated that overexpression of OsMED16 strengthened rice resistance to Guy11, and the knockout lines exhibited weaker resistance to the disease (Fig. 1C–E), showing that OsMED16 has a positive regulatory effect on blast resistance in rice. It was recently reported that over-expression of the OsMed16 gene (3906 bp) results in spontaneous cell death in the leaf blade and sheath with a constitutionally activated immune response (Jiang et al. 2021). Although the overexpression plants of OsMED16 (3513 bp) also showed enhanced resistance to M. oryzae, there was no spontaneous cell death in the leaves, which may result from the truncated 131 amino acids residues at the N-terminal of OsMED16.
OsMED16 Interacts with OsWRKY45 in the Nucleus
For further investigation of the possible mechanisms by which OsMED16 regulates disease resistance in rice, full-length OsMED16 was used to screen a yeast two-hybrid (Y2H) library of rice to identify potential interacting proteins. Among those candidates, OsWRKY45 (Os05t0322900-01) was found to interact with OsMED16. And the 1:1 yeast two hybrid was performed between OsMED16 and OsWRKY45 to confirm this interaction (Fig. 2A). The interaction between OsMED16 and OsWRKY45 in vivo was confirmed by biomolecular fluorescence complementation (BiFC) assays, and the complex occurred in the nucleus (Fig. 2B).
OsMED16 and OsWRKY45 Synergistically Activate Diterpenoid Phytoalexin Biosynthesis Genes Transcription
The expression levels of the genes involved in rice diterpenoid phytoalexin (DP) synthesis in rice were detected in the leaves of wild-type and transgenic plants using RT-qPCR. The results revealed that diterpenoid phytoalexin biosynthesis genes were up-regulated in OsMED16 overexpressing plants and down-regulated in OsMED16 knockout plants under normal and M. oryzae infection conditions (Fig. 3).
Previous research has indicated that OsWRKY45 can regulate diterpenoid phytoalexin synthesis genes expression, and improve rice resistance to rice blast (Akagi et al. 2014). Thus, we further investigated the role of the OsMED16-OsWRKY45 complex in regulating the transcription of genes involved in DP synthesis. According to the DP biosynthesis-related gene expression profiles in the OsMED16 transgenic lines, we cloned the promoters of several DP biosynthesis-related genes (approximately 2000 bp in the upstream of ATG) including proOsCSP2, proOsCSP4, proOsCYP71Z6, proOsCYP71Z7, proOsCYP99A2, proOsCYP999A3, proOsKSL4, proOsKSL7, proOsKSL10, proOsMAS1, and proOsDPF which was reported as a basic helix–loop–helix (bHLH)-type transcription factor involved in directly regulating diterpenoid phytoalexin genes (Yamamura et al. 2015). As shown in Additional file 1: Figs. S5 and Fig. 4A, Y1H assays show that OsWRKY45 was able to bind directly to proOsCYP99A3 (893 bp upstream of ATG), proOsKSL10 (1637 bp upstream of ATG) and proOsDPF (1690 bp in the upstream of ATG) Sequence analysis indicated that there was at least one W-box in the promoter region of OsCYP99A3, OsKSL10, and OsDPF (Fig. 4B). As a control, OsMED16 could not interact with proOsCYP99A3, proOsKSL10 and proOsDPF (Additional file 1: Fig. S11). Further, The firefly luciferase (LUC) driven by the DP biosynthesis-related genes promoters (proOsCYP99A3::LUC, proOsKSL10::LUC, and proDPF::LUC) and renilla luciferase (REN) driven by 35S promoter (35S: REN) were transformed transiently into N.benthamiana leaves with 35S: OsWRKY45 or empty vector (pGreen II 62-SK), respectively (Fig. 4C and Additional file 1: Fig. S7). The promoter activity was expressed as Luc luminescence intensity and the ratio of Luc activity to Renilla luciferase (REN) activity. The result shows that compared with the control vector, the expression levels of proOsCYP99A3::LUC, proOsKSL10::LUC and proDPF::LUC were significantly activated in the presence of OsWRKY45 (Fig. 4D, E). Our results suggest that 35S: OsWRKY45 could indeed bind to the promoters of OsCYP99A3, OsKSL10 and OsDPF to activate the transcription of a downstream reporter gene. Moreover, in the presence of OsMED16, The luminescence intensity of firefly luciferase of proOsCYP99A3::LUC, proOsKSL10::LUC and proOsDPF::LUC was further enhanced (Fig. 4D, E), indicating that OsMED16 could recruit more RNA polymerase II and enhance the regulatory effect of OsWRKY45 on the promoter. In conclusion, our results show that co-expression of OsMED16 and OsWRKY45 could elevate the DP biosynthesis-related gene promoters’ transcriptional activity.
OsMED16-OsWRKY45-OsWRKY62 Complex can Further Synergistically Activate Diterpenoid Phytoalexin Biosynthesis Genes Transcription
The previous study has shown that OsWRKY62 interacts with OsWRKY45 to form a heterodimer that activate the expression of OsDPF (Fukushima et al. 2016). And the 1:1 yeast two hybrid was performed between OsMED16 and OsWRKY45 to confirm this interaction.The Y2H assay shows that, consistent with the previous study, OsWRKY62-1 and OsWRKY62-2 interact with OsWRKY45 (Fig. 5A). BIFC assays showed that both OsWRKY62-1 and OsWRKY62-2 interact with OsWRKY45 and these interactions occur in the nucleus (Fig. 5B). However, Neither OsWRKY62-1 nor OsWRKY62-2 interacts with OsMED16 (Fig. 5A). Further Y1H assay showed that OsWRKY62 can directly bind to the promoters of OsCYP99A3, OsKSL10 and OsDPF (Fig. 6A). This indicates that OsWRKY62 may be involved in the transcriptional regulation of genes related to the biosynthesis of diterpenoid phytoalexins. To test how the OsWRKY62 protein participates in the OsMED16-OsWRKY45 complex to regulate target genes’ expression, we first employed the Y1H assay to detect whether OsWRKY62 (OsWRKY62-1) binds to the promoters of OsCYP99A3, OsKSL10, and OsDPF. As shown in Fig. 6A, OsWRKY62 was able to bind directly to the promoters of OsCYP99A3, OsKSL10, and OsDPF. This indicates that OsWRKY62 is probably involved in diterpenoid phytoalexin biosynthesis-related gene transcriptional regulation.
Next, the dual luciferase assay was employed to test how the OsWRKY62 protein participates in the OsMED16-OsWRKY45 complex to regulate the expression of target genes. Compared with 35S::OsWRKY45 and 35S::OsMED16 co-expressed. the expression levels of proOsCYP99A3::LUC, proOsKSL10::LUC, and proDPF::LUC found to be further activated when 35S::OsWRKY45,35S::OsMED16 and 35S::OsWRKY62 were co-expressed (Fig. 6B–D, Additional file 1: S12 and S13). As the data shown above, the OsMED16-OsWRKY45-OsWRKY62 complex was able to bind to the promoter regions of several phytoalexin synthesis-associated genes to promote the transcriptional level. Compared with the OsMED16-OsWRKY45 complex, the OsMED16-OsWRKY45-OsWRKY62 complex could further synergistically activate phytoalexin synthesis-related gene transcription.
Discussion
The Multiple Roles of Mediator in Plant Disease Resistance
The regulation of gene transcription in higher eukaryotes is a complex and delicate process that requires the involvement of many components including gene-specific transcription factor, RNA polymerase II, general transcription factors (GTFs), and mediator complex (MED), in which MED plays a central role in the gene transcription regulation (Kornberg 2005). Since the first report of mediator complexes in plants in 2007, abundant subsequent works have confirmed that mediator complexes in plants have significant roles in the regulation of gene transcription. With the development of bioinformatics and gene function research methods in recent years, there have been several reports on the involvement of subunits of the mediator complex in plant defense. For instance, In Arabidopsis, MED25 was found to regulate plant disease resistance defense depending on the jasmonic acid (JA) signaling pathway; Subsequent studies found that MED25 interacted with MYC2, a transcription factor of the jasmonic acid pathway, revealing a clearer MED25-mediated defense pathway(Kidd et al. 2009; Cevik et al. 2012). In a similar vein, AtMED8, 12, 13, 16, 21, and CDK8 have been found to regulate resistance to necrotrophic pathogens in the jasmonate/ethylene (JA/ET) depended manner (Dhawan et al. 2009; Zhang et al. 2012; Zhu et al. 2014; Zhai et al. 2019). The AtMED16 was identified to enhance resistance to Pseudomonas syringae in Arabidopsis by controlling both SA- and JA-mediated defense gene expression (Wathugala et al. 2012). The above results illustrate that plant MEDs are involved in plant defense responses through multiple signaling pathways.
Magnaporthe oryzae is a hemibiotrophic fungus. It causes rice blast, the most devastating disease of food crops. Although plant MEDs have been researched extensively in Arabidopsis, the mediator complex's molecular mechanisms in crop immunity to hemibiotrophic fungus is not well clarified. In this work, we describe the role of OsMED16, a tail subunit of the rice MED, in positively regulating the response to rice blast (Fig. 1C–E). We demonstrated that OsMED16 regulates plant immunity via positively regulating phytoalexin synthesis by forming a complex with OsWRKY45 and OsWRKY62 to promote the transcriptional levels of several phytoalexin synthesis-related genes such as OsCYP99A3, OsKSL10 and OsDPF (Figs. 3, 4, 6). Our results reveal a multilayered OsMED16 protein-mediated plant defense system that further deepens our understanding of disease resistance in plant MEDs.
OsMED16 Further Enhances the Transcriptional Activity of Transcription Factors in Promoting the Transcriptional Level
In all eukaryotes, the mediator complex has a vital role in transcriptional regulation, in which RNA Pol II is involved transcriptional initiation occurs in the gene promoter region, where the chromatin remodeling complex exposes the nucleosome, which allows the transcriptional pre-initiation complex (PIC) to assemble. The mediator complex could transmit regulatory messages to the fundamental transcriptional machinery during transcription via conformational changes, forming a surface that could be flexible enough to facilitate the PIC-Mediator transcriptional initiation supercomplex assembly (Chadick et al. 2005; Chen et al. 2021, 2022). Regulation of the signal transmission from DNA-binding TFs directly to the RNA Pol II enzyme is an important function of the MEDs. During transcription, Mediator recruits RNA polymerase II by interacting with the RNA polymerase II RPB1 subunit C-terminal structural domain (CTD), while transcription factors do not bind RNA Pol II directly, but TFs can facilitate the recruitment of RNA polymerase II, thereby completing gene transcription (Myers et al. 1998; Näär et al. 2002). Mediator interaction with TF further promotes the forming of the RNA polymerase II PIC via influencing the efficiency and velocity of the reaction in a way that enhances the transcriptional activity of the TF (Cantin et al. 2003). In plants, mediator complexes can act as transcriptional activators involved in gene regulation. For instance, In Arabidopsis, MED18 associated with the TF ABI4 (abscisic acid INSENSITIVE4) further enhances the transcriptional activity of ABI4 on ABI5 (Lai et al. 2014). The amino- and carboxy-terminal portions of TaEIL1 associate with the conserved activator interaction structural domain of TaMED25 to synergistically activate the transcription of TaERF1, thus changing the basic resistance to powdery mildew in bread wheat (Liu et al. 2016). AtCDK8, a subunit of the mediator complex, promotes the expression of PR1 and NPR1 via the recruitment of RNA Pol II to their promoter regions by associating with the transcription factors TGA, WRKY6 and WRKY8 (Chen et al. 2019).
In our research, we showed that once OsMED16 was additionally added into the system with OsWRKY45 or OsWRKY45-OsWRKY62 complex, the expression levels of OsCYP99A3, OsKSL10, and OsDPF were further activated (Figs. 4, 6), which indicates that when OsMED16 is present, more RNA polymerase II can be enrolled into the promoter region to enhance the transcription levels. In summary, OsMED16 acts as a central function in the regulation of plant phytoalexin genes, and OsMED16 could enhance the transcriptional activity of OsWRKY45 and OsWRKY45-OsWRKY62 heterodimers by recruiting more RNA Pol II (Fig. 7).
Role of OsMED16 Gene in Disease Resistance of Rice
In Arabidopsis, AtMED16 is a positive regulator of plant disease resistance defense (Wathugala et al. 2011; Zhang et al. 2012). In this study, The OsMED16 that we cloned encodes 1170 amino acids, or named OsSRF6 of 3513 bp as reported by Wathugala et al. (Wathugala et al. 2011); 1–393 bp truncated of the 3903 bp Os10g0498700-01at 5′ end. The expression of OsMED16 (OsSFR6) in the atmed16 (atsfr6) mutant background restored the visible phenotype of the wild type. This suggests that there is a functional similarity between OsMED16 (OsSFR6) and AtMED16 (Wathugala et al. 2011). Our experiments showed that overexpressing OsMED16(OsSFR6) positively regulates rice resistance to rice blast in a Nipponbare background (Fig. 1C, D), which is similar to the function of AtMED16, However, this differs from recent studies showing that overexpression of full-length OsMED16 (3906 bp) in “Zhonghua 11” as a negative regulator, In their study, they found that overexpression of the OsMED16 gene (3906 bp) in japonica rice Zhonghua 11 “ZH11” enhanced rice susceptibility to rice blast, with no obvious lesion mimic phenomenon in the leaves (Zhang et al. 2023). Another functional research on OsMED16 (3906 bp) is Jiang et al. (Jiang et al. 2021). They found that overexpression of OsMED16 in Nipponbare resulted in growth inhibition, yield reduction and the appearance of lesion mimic phenotype. RNA-Seq analysis showed that overexpression of OsMED16 resulted in the up-regulation of a large number of disease resistance-related genes, including the disease resistance gene OsWRKY45, which is relevant to our study, as well as the widely reported resistance genes to rice blast, OsPR1a, OsPR1b and OsPAL1. Maybe it was the different backgrounds used that made the Jiang et al. and Zhang et al. overexpression plant exhibits different phenotypes. We analyzed the differences between OsMED16 (OsSFR6 3513 bp) and OsMED16 (3906 bp) and found that the 131 amino acids lacking in our cloned OsMED16 (OsSFR6) was enriched with Gly (41/131) which may be the reason for the differences in disease resistance functions between OsMED16 (OsSFR6) and OsMED16(3906 bp). The reason for the opposite disease resistance regulatory functions exhibited by OsMED16 (3513 bp) and OsMED16 (3906 bp) could also be that using different background materials.
Interestingly, when we knocked out OsMED16 using the CRISPR/Cas9 system, we obtained double-stranded and single-stranded effectively edited lines (Additional file 1: Fig. S1A and Fig. 1B). Consistent with previous studies, the double-stranded knockdown lines we obtained also showed seedling lethality (Additional file 1: Fig. S1B), but only the single-stranded effectively edited lines showed unrestricted growth. Further identification of disease resistance revealed that the knockout strain was more susceptible to rice blast disease than the wild type (Fig. 1C, D), which was similar to the results of Zhang et al. (2021), who silenced OsMED16 plants using VIGS, suggesting that OsMED16 is a positive regulator of rice blast disease in rice. The reason for this difference from the recently reported (Zhang et al. 2023) findings of OsMED16 knockout plants being more resistant to disease could be that phenotypic differences between knockouts and knockdowns could be caused by genetic compensation responses, as in plants (Gao et al. 2015; Wang et al. 2023) and zebrafish (Ma et al. 2019). Alternatively, the observed disparity could potentially be attributed to varietal differences and variations in the pathogens employed across the studies.
OsMED16 may also Increase Rice Resistance Against Rice Blast by Regulating H2O2 Accumulation
Hydrogen peroxide was a signal for plant disease resistance and it had a toxic effect on pathogenic (Li et al. 2021). It has been found that rice disease-resistant rice would accumulate hydrogen peroxide more readily than disease-susceptible rice (Li et al. 2014). In this study, we also found that the accumulation of H2O2 was significantly increased in the OsMED16 overexpression plants (Additional file 1: Fig. S8A and B). Meanwhile, the expression of H2O2 synthesis-related genes was increased in OsMED16 overexpression lines and decreased in knockout lines (Additional file 1: Fig. S8C). The expression of H2O2 degradation-related genes exhibited the opposite trend (Additional file 1: Fig. S8D).
Although we found that many H2O2 synthesis and degradation-related genes have W-boxes on their promoters (Additional file 1: Fig. S9A), However, the dual-luciferase reporter system assay results indicated that OsWRKY45 and OsMED16 did not enhance the expression of H2O2 synthesis and degradation-related genes (Additional file 1: Figs. S9B and S10). Therefore, it is hypothesized that OsMED16 regulation of hydrogen peroxide synthesis in rice is not dependent on OsWRKY45, and there may be other transcription factors recruited by OsMED16 for the regulation of H2O2 synthesis.
Methods and Materials
Plant Material, Growth Conditions
The Nipponbare variety wild type (WT) rice (Oryza sativa L.subsp. Japonica) was used as control material and transgenic analysis, the rice was grown during the normal season in experimental fields in Wuhan, China (average daily temperature about 28 °C). Nicotiana Benthamiana seeds were planted in nutrient soil in pots and maintained at 25 °C ambient temperature, 60% relative humidity and 8 h/16 h/dark/light photoperiod in a greenhouse.
Phylogenetic Analysis
We obtained protein sequences homologous of MED16 from 10 different species from the NCBI (https://www.ncbi.nlm.nih.gov/) database by BLAST search. Multiple sequence comparison was performed using the Clustal W program. The aligned sequences were used to construct a phylogenetic tree in MEGA6 using the neighbour-joining method, with PoissionModel, partial deletion and bootstrap parameters replicated 1000 times.
Vector Construction and Rice Transformation
The 3513 bp coding sequence of the OsMED16 gene was amplified and inserted into the pU1301-CaMV35S vector, which was linearised using Kpn I and BamH I enzymes (Additional file 1: Fig. S3). This was done using the ClonExpress II one-step cloning kit (Vazyme, Nanjing, China). The resulting overexpression vector was then used to obtain transgenic plants through the Agrobacterium-mediated method, by inducing embryonic healing tissues from NPB. For the construction of the CRISPR/Cas9-med16 knockout vector, we designed two gRNAs based on the OsMED16 DNA sequence as well as gene structure in CRISPR-P 2.0 (http://crispr.hzau.edu.cn/CRISPR2/) (Liu et al. 2017) (gRNA1: 5 'AATGCACGAGGGCATGATCG 3′; gRNA2: 5′ GTGTTCACATTGCCAGGAAC3′) (Additional file 1: Supplementary Fig. S4). Based on published methods (Xie et al. 2015), three primer pairs L5AD5-F/OsMED16-gRNA1-U3-R, OsMED16-gRNA1-U3-F/OsMED16-gRNA2-U3R, and OsMED16-gRNA2-U3-F/L5AD5-R amplification were performed by PCR, and three PCR products were diluted 20–50 times and mixed in equal volumes. S5AD5-F/S5AD5-R primer pairs were used for amplification, and the resulting PCR products were then cloned onto the pRGEB32 vector using the In-Fusion HD Cloning Kit. Subsequent Agrobacterium EHA105-mediated transformation of rice callus was performed to obtain OsMED16 knockout transgenic plants. Primers used in this study were listed in Additional file 2: Supplemental Table S1.
RNA Extraction and Expression Analysis
Rice total RNA was extracted using the RNA Extraction Kit (Promega, USA), and performed according to the instructions provided by the manufacturer. A GoScript reverse transcription kit was used to synthesise the first strand of cDNA, amplified from 1 μg of total RNA as described in the instructions and finally diluted 1 0 0 times with ddH2O. The expression of the relevant genes was assessed using the rice OsActin1 gene (LOC_Os03g50885) as an internal control. Realtime fluorescent quantitative PCR (RT-qPCR) was conducted utilizing SYBR Green Master Mix (Applied Biosystems, USA) on a CFX Connect Real-time System (Bio-RAD, USA) Each experiment consisted of three biological replicates and three technical replicates.
Pathogen Preparation, Infection
The M. oryzae isolate Guy11 was kindly provided by the research team of Professor Huang Junbin (Huazhong Agricultural University). M. oryzae preparation and inoculation were carried out in accordance with published methods (Li et al. 2017), The M. oryzae strain Guy11 was inoculated on complete agar and cultivated in a climatic chamber at 25 °C for 7–9 days until the mycelium covered the entire petri dish. Subsequently, the strain was eluted into tomato oat medium with ddH20, and after 4–5 days of incubation in a 25 °C climatic chamber, Guy11 spores were eluted with 0.25% tween water, and 8–10 μl were placed on leaves in the middle of four-leafed stage plants, which were grown in a 12 h/12 h (day/night) climatic chamber at a temperature of 26 °C and relative humidity of 90% for 5 d. The experiment was repeated three times and the lesion sizes was measured using ImageJ 1.32j software. It was repeated three times for all experiments and measurement of lesion sizes on inoculated leaves using ImageJ 1.32j software. The determination of the relative infection rate of blast fungus in rice cells was carried out as previously described (Deng et al. 2017), and at least 15 DNA samples were tested for each inoculation.
Hydrogen Peroxide Detection
The inoculated isolated leaves were stained with 0.5 mg/mL DAB staining solution, and the procedure was to place the inoculated isolated leaves in a vacuum oven with a centrifuge tube containing DAB staining solution and then evacuated for 30 min and incubated overnight at room temperature with shade.The leaves were washed with ddH2O and placed in a solution of acetone: methanol = 1:1 to remove the dechlorophyll. Pictures were taken with a stereo microscope (Leica, VT1000S, Germany). The detection of H2O2 was performed according to the H2O2 quantitative analysis kit (Shanghai Sangon, China).
Yeast Two-Hybrid (Y2H) Assay
Following the manufacturer’s instructions, we used Match-maker Library Construction and Screening Kits (Clontech) to construct a rice cDNA library from leaves infected with Guy11 for use in this investigation.In 1:1 yeast two hybrid system, for the construction of the baited vector BD-OsMED16, BD-OsMED19 and BD-OsWRKY45, full-length CDS of OsMED16, OsMED19 and OsWRKY45 were amplified with corresponding primer pairs primers and cloned into the vector pGBKT7, and subsequently transformed into yeast strain Y2H. The full-length CDS of OsMED16, OsWRKY62-1 and OsWRKY62-2 were amplified with corresponding primer pairs and cloned them into pGADT7 and subsequently transformed into yeast strain Y187. The positive plasmid-transformed Y187 and Y2H strains were selected on SD-Leu-Trp, SD-Leu-Trp-His and SD-Leu-Trp-His-Ade media to confirm the interaction, according to the experimental objectives (Hu et al. 2018).
Bimolecular Fluorescence Complementation (BiFC) Assay
To generate the BiFC constructs, the full length of OsMED16 OsWRKY62-1, OsWRKY62-2 and OsWRKY45 were amplified with corresponding primer pairs and inserted into pS1301nYFP or pS1301cYFP vectors between BamHI and SalI (Yuan et al. 2010). The plasmids of OsMED16-cYFP, OsWRKY45-nYFP, OsMED16-cYFP, pS1301cYFP and the nuclear marker [mCherry-AtHY5, Zhao et al. (2019)] were transformed into Agrobacterium tumefaciens strain GV3101 by chemical transformation and subsequently co-infiltrated into leaves of Nicotiana benthamiana (Chen et al. 2008; Hu et al. 2021a, b). Fluorescence signals in leaf epidermal cells were observed using a confocal microscope (Olympus FV1200).
Yeast One-Hybrid (Y1H) Assay
Yeast one-hybrid assays were performed using the Matchmaker One Hybridisation System Manual (Clontech) to confirm the interaction between OsMED16, OsWRKY45, OsWRKY62-1 and the promoters of their hypothetical targets. To obtain the bait vector, the promoter sequence was inserted into the pAbAi vector (Additional file 1: Fig. S5). The full-length of OsMED16, OsWRKY45, and OsWRKY62-1 were inserted into the pGADT7 vector to obtain OsMED16-AD, OsWRKY45-AD, OsWRKY62-1-AD as the prey vector, and the two vectors were transformed into the Y1HGold strain. Yeast cells were cultured for 3–5 d at 30 °C on SD/-Leu and SD/-Ura-Leu synthesis media supplemented with the optimal ABA (Aureobasidin A) concentration according to the screening assay for optimal concentrations to suppress bait reporter strains (Additional file 1: Fig. S6) to identify the interaction between OsMED16, OsWRKY45, OsWRKY62-1 and each promoter.
Dual-Luciferase (LUC) Reporter Assays
The promoter sequences of OsCYP99A3, OsKSL10, OsDPF, OsRbohB, OsRbohF, OsCAT-B, OsGPX2, OsAPX4, OsAPX5 and OsAPX7 were amplified with ProOsCYP99A3-0800-F/R, ProOsKSL10-0800-F/R, ProOsDPF-0800-F/R, ProOsRbohB-0800-F/R, ProOsRbohF-0800-F/R, ProOsCAT-B-0800-F/R, ProOsGPX2-0800-F/R, ProOsAPX4-0800-F/R, ProOsAPX5-0800-F/R and ProOsAPX7-0800-F/R primer pairs, and then respectively inserted into pGreenII 0800 vector at Hind III and BamH I sites to obtain the ProOsCYP99A3-LUC, ProOsCYP99A3-LUC, ProOsDPF-0800-LUC, ProOsRbohB-LUC, ProOsRbohF-LUC, ProOsCAT-B-LUC, ProOsGPX2-LUC, ProOsAPX4-LUC, ProOsAPX5-LUC and ProOsAPX7-LUC vectors as reporter constructs. The full lengths of OsMED16, OSWRKY45 and OsWRKY62-1 were amplified with OsMED16-SK-F/R, OsWRKY45-SK-F/R and OsWRKY62-SK-F/R primers. The resulting PCR products were then inserted into the pGreenII 62-SK vector respectively at the BamH I and ECOR I sites to obtain the effectors SK-OsMED16, SK-OsWRKY45, and SK-OsWRKY62 vectors. and the pGreenII 62-SK vector without any DNA insertion was used as the empty vector control. To obtain SK-OsMED16-OsWRKY45 and SK-OsMED16-OsWRKY62 vectors, we first modified the pGreenII 62-SK vector as shown in the attached Additional file 1: Fig. S7. Firstly, the full-length NOS terminator was ligated into the 62-SK vector to obtain the 62-SK-NOS vector, Subsequently, after SalI digestion, the full length of the 35 s promoter was inserted into the 62-SK-NOS vector, and finally construct an expression vector D35s-62-SK with two 35 s promoters in tandem. Next, the full length of OsMED16 was inserted into the D35s-62-SK vector to generate the SK-35 s-MED16 vector. Subsequently, the full lengths of OsWRKY45 were inserted into the SK-35 s-MED16 vector to obtain SK-OsMED16-OsWRKY45 vectors as effectors. The luminescence imaging analysis was performed according to the previously reported method (Chen et al. 2008; Hu et al. 2021a, b). The activity analysis of LUC and REN was performed according to the method described in the instructions of the dual luciferase kit (Sangon, Shanghai, China). The ratio of Luc activity were performed using a multi-mode plate reader (PerkinElmer, USA) to calculate to control REN activity.
Conclusion
In this study, we investigated the function of OsMED16, a subunit of the rice mediator factor complex, to gain new insights into the regulation of rice resistance to rice blast. Here, we found that OsMED16 (OsSFR6) promotes the transcript levels of several genes related to phytoalexin synthesis by forming a complex with OsWRKY45 and OsWRKY62, thereby enhancing rice resistance to rice blast.The dual mechanisms of functional differences between OsMED16/OsSFR6 (3513 bp) and OsMED16 (3906 bp) are also worthy of further investigation.
Availability of Data and Materials
All relevant data in this study can be found within the manuscript and its supporting information files.
Abbreviations
- RNA Pol II:
-
RNA polymerase II
- DP:
-
Diterpenoid phytoalexin
- qRT-PCR:
-
Reverse transcription quantitative PCR
- WT:
-
Wild-type
- OE:
-
Overexpression
- JA:
-
Jasmonic acid
- ET:
-
Ethylene
- SA:
-
Salicylic acid
- MED:
-
Mediator complex
- GTFs:
-
General transcription factors
- PIC:
-
Pre-initiation complex
- CTD:
-
C-terminal structural domain
- TF:
-
Transcription factor
- NPB:
-
Nipponbare
- AbA:
-
Aureobasidin A
References
Ahuja I, Kissen R, Bones AM (2012) Phytoalexins in defense against pathogens. Trends Plant Sci 17:73–90. https://doi.org/10.1016/j.tplants.2011.11.002
Akagi A, Fukushima S, Okada K, Biology C-JJJPM (2014) WRKY45-dependent priming of diterpenoid phytoalexin biosynthesis in rice and the role of cytokinin in triggering the reaction. Plant Mol Biol 86:171–183. https://doi.org/10.1007/s11103-014-0221-x
Bckstrm S, Elfving N, Nilsson R, Wingsle G, Bjrklund SJMC (2007) Purification of a plant mediator from Arabidopsis thaliana identifies PFT1 as the Med25 subunit. Mol Cell 26:717–729. https://doi.org/10.1016/j.molcel.2007.05.00
Caillaud M-C, Asai S, Rallapalli G, Piquerez S, Fabro G, Jones JDG (2013) A downy mildew effector attenuates salicylic acid-triggered immunity in Arabidopsis by interacting with the host mediator complex. PLoS Biol 11:e1001732. https://doi.org/10.1371/journal.pbio.1001732
Canet JV, Dobon A, Tornero PJPC (2012) Non-recognition-of-BTH4, an Arabidopsis mediator subunit homolog, is necessary for development and response to salicylic acid. Plant Cell 24:4200–4235. https://doi.org/10.1105/tpc.112.103028
Cantin GT, Stevens JL, Berk AJ (2003) Activation domain–mediator interactions promote transcription preinitiation complex assembly on promoter DNA. Proc Natl Acad Sci U S A 100:12003–12008. https://doi.org/10.1073/pnas.2035253100
Cartwright D, Langcake P, Pryce RJ, Leworthy DP, Ride JP (1977) Chemical activation of host defence mechanisms as a basis for crop protection. Nature 267:511–513. https://doi.org/10.1038/267511a0
Cartwright DW, Langcake P, Pryce RJ, Leworthy DP, Phytochemistry JPRJ (1981) Isolation and characterization of two phytoalexins from rice as momilactones A and B. Phytochemistry 20:535–537. https://doi.org/10.1016/S0031-9422(00)84189-8
Cevik V, Kidd BN, Zhang P, Hill C, Kiddle S, Denby KJ, Holub EB, Cahill DM, Manners JM, Schenk PM, Beynon J, Kazan K (2012) MEDIATOR25 acts as an integrative hub for the regulation of jasmonate-responsive gene expression in Arabidopsis. Plant Physiol 160:541–555. https://doi.org/10.1104/pp.112.202697
Chadick JZ, Asturias FJJTIBE (2005) Structure of eukaryotic mediator complexes. Trends Biochem Sci 30:264–271. https://doi.org/10.1016/j.tibs.2005.03.001
Chen H, Zou Y, Shang Y, Lin H, Wang Y, Cai R, Tang X, Zhou JM (2008) Firefly luciferase complementation imaging assay for protein-protein interactions in plants. Plant Physiol 146:368–376. https://doi.org/10.1104/pp.107.111740
Chen J, Mohan R, Zhang Y, Li M, Chen H, Palmer IA, Chang M, Qi G, Spoel SH, Mengiste T, Wang D, Liu F, Fu ZQ (2019) NPR1 promotes its own and target gene expression in plant defense by recruiting CDK8. Plant Physiol 181:289–304. https://doi.org/10.1104/pp.19.00124
Chen X, Wang X, Liu W, Ren Y, Qu X, Li J, Yin X, Xu Y (2022) Structures of +1 nucleosome-bound PIC-Mediator complex. Science 378:62–68. https://doi.org/10.1126/science.abn8131
Chen X, Yin X, Li J, Wu Z, Qi Y, Wang X, Liu W, Xu Y (2021) Structures of the human Mediator and Mediator-bound preinitiation complex. Science. https://doi.org/10.1126/science.abg0635
Cho E-M, Okada A, Kenmoku H, Otomo K, Toyomasu T, Mitsuhashi W, Sassa T, Yajima A, Yabuta G, Mori K, Oikawa H, Toshima H, Shibuya N, Nojiri H, Omori T, Nishiyama M, Yamane H (2004) Molecular cloning and characterization of a cDNA encoding ent-cassa-12,15-diene synthase, a putative diterpenoid phytoalexin biosynthetic enzyme, from suspension-cultured rice cells treated with a chitin elicitor. Plant J 37:1–8. https://doi.org/10.1046/j.1365-313X.2003.01926.x
Deng Y, Zhai K, Xie Z, Yang D, Zhu X, Liu J, Wang X, Qin P, Yang Y, Zhang G, Li Q, Zhang J, Wu S, Milazzo J, Mao B, Wang E, Xie H, Tharreau D, He Z (2017) Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 355:962–965. https://doi.org/10.1126/science.aai8898
Dhawan R, Luo H, Foerster AM, Abuqamar S, Du HN, Briggs SD, Scheid OM, Mengiste TJTPCO (2009) HISTONE MONOUBIQUITINATION1 interacts with a subunit of the mediator complex and regulates defense against necrotrophic fungal pathogens in Arabidopsis. Plant Cell. https://doi.org/10.1105/tpc.108.062364
Dolan WL, Dilkes BP, Stout JM, Bonawitz ND, Chapple C (2017) Mediator complex subunits MED2, MED5, MED16, and MED23 genetically interact in the regulation of phenylpropanoid biosynthesis. Plant Cell 29:3269–3285. https://doi.org/10.1105/tpc.17.00282
Fukushima S, Mori M, Sugano S, Takatsuji H (2016) Transcription factor WRKY62 plays a role in pathogen defense and hypoxia-responsive gene expression in rice. Plant Cell Physiol 57:2541–2551. https://doi.org/10.1093/pcp/pcw185
Gao Y, Zhang Y, Zhang D, Dai X, Estelle M, Zhao Y (2015) Auxin binding protein 1 (ABP1) is not required for either auxin signaling or Arabidopsis development. Proc Natl Acad Sci U S A 112:2275–2280. https://doi.org/10.1073/pnas.1500365112
Kato H, Kodama O, Akatsuka T (1993) Oryzalexin E, A diterpene phytoalexin from UV-irradiated rice leaves. Phytochemistry 33:79–81. https://doi.org/10.1016/0031-9422(93)85399-c
Hu Q, Zhu L, Zhang X, Guan Q, Xiao S, Min L, Zhang X (2018) GhCPK33 negatively regulates defense against Verticillium dahliae by phosphorylating GhOPR3. Plant Physiol 178:876–889. https://doi.org/10.1104/pp.18.00737
Hu H, Tang Y, Wu J, Chen F, Yang Y, Pan X, Dong X, Jin X, Liu S, Du X (2021a) Brassica napus mediator subunit16 induces BnMED25- and BnWRKY33-activated defense signaling to confer Sclerotinia sclerotiorum resistance. Front Plant Sci 12:663536. https://doi.org/10.3389/fpls.2021.663536
Hu Q, Xiao S, Wang X, Ao C, Zhang X, Zhu L (2021b) GhWRKY1-like enhances cotton resistance to Verticillium dahliae via an increase in defense-induced lignification and S monolignol content. Plant Sci 305:110833. https://doi.org/10.1016/j.plantsci.2021.110833
Inoue Y, Sakai M, Yao Q, Tanimoto Y, Toshima H, Hasegawa M (2013) Identification of a novel casbane-type diterpene phytoalexin, ent-10-oxodepressin, from rice leaves. Biosci Biotechnol Biochem 77:760–765. https://doi.org/10.1271/bbb.120891
Jiang J, Yang G, Xin Y, Wang Z, Yan W, Chen Z, Tang X, Xia J (2021) Overexpression of OsMed16 inhibits the growth of rice and causes spontaneous cell death. Genes (basel). https://doi.org/10.3390/genes12050656
Katagiri F (2004) A global view of defense gene expression regulation–a highly interconnected signaling network. Curr Opin Plant Biol 7:506–511. https://doi.org/10.1016/j.pbi.2004.07.013
Kato H, Kodama O, Akatsuka TJP (1994) Oryzalexin F, a diterpene phytoalexin from UV-irradiated rice leaves. Phytochemistry 36:299–301. https://doi.org/10.1016/S0031-9422(00)97064
Kidd BN, Edgar CI, Kumar KK, Aitken EA, Schenk PM, Manners JM, Kazan KJTPCO (2009) The mediator complex subunit PFT1 is a key regulator of jasmonate-dependent defense in Arabidopsis. Plant Cell. https://doi.org/10.1105/tpc.109.066910
Kodama O, Xin Li W, Tamogami S, Akatsuka TJJOTACSOJ (1992) Oryzalexin S, a novel stemarane-type diterpene rice phytoalexin. Biosci Biotechnol Biochem 56:1002–1003. https://doi.org/10.1271/bbb.56.1002
Koga S, Oshima O, Cheminform YJ (1995) Phytocassanes A, B, C and D, novel diterpene phytoalexins from rice, Oryza sativa L. Tetrahedron 51:7907–7918. https://doi.org/10.1016/0040-4020(95)00423-6
Koga J, Ogawa N, Yamauchi T, Kikuchi M, Shimura MJP (1997) Functional moiety for the antifungal activity of phytocassane E, a diterpene phytoalexin from rice. Phytochemistry 44:249–253. https://doi.org/10.1016/S0031-9422(96)00534-1
Kornberg RD (2005) Mediator and the mechanism of transcriptional activation. Trends Biochem Sci 30:235–239. https://doi.org/10.1016/j.tibs.2005.03.011
Lai Z, Schluttenhofer CM, Bhide K, Shreve J, Thimmapuram J, Lee SY, Yun DJ, Mengiste T (2014) MED18 interaction with distinct transcription factors regulates multiple plant functions. Nat Commun 5:3064. https://doi.org/10.1038/ncomms4064
Li Y, Lu YG, Shi Y, Wu L, Xu YJ, Huang F, Guo XY, Zhang Y, Fan J, Zhao JQ, Zhang HY, Xu PZ, Zhou JM, Wu XJ, Wang PR, Wang WM (2014) Multiple rice microRNAs are involved in immunity against the blast fungus Magnaporthe oryzae. Plant Physiol 164:1077–1092. https://doi.org/10.1104/pp.113.230052
Li W, Zhu Z, Chern M, Yin J, Yang C, Ran L, Cheng M, He M, Wang K, Wang J, Zhou X, Zhu X, Chen Z, Wang J, Zhao W, Ma B, Qin P, Chen W, Wang Y, Liu J, Wang W, Wu X, Li P, Wang J, Zhu L, Li S, Chen X (2017) A natural allele of a transcription factor in rice confers broad-spectrum blast resistance. Cell 170:114-126.e115. https://doi.org/10.1016/j.cell.2017.06.008
Li P, Zhao L, Qi F, Htwe N, Li Q, Zhang D, Lin F, Shang-Guan K, Liang Y (2021) The receptor-like cytoplasmic kinase RIPK regulates broad-spectrum ROS signaling in multiple layers of plant immune system. Mol Plant 14:1652–1667. https://doi.org/10.1016/j.molp.2021.06.010
Liu C, Jie ZT, Jia J, Sun JJPP (2016) The wheat mediator subunit TaMED25 interacts with the transcription factor TaEIL1 to negatively regulate disease resistance against powdery mildew. Plant Physiol 170:1799–1816. https://doi.org/10.1104/pp.15.01784
Liu H, Ding Y, Zhou Y, Jin W, Xie K, Chen L-L (2017) CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol Plant 10:530–532. https://doi.org/10.1016/j.molp.2017.01.003
Liu Z, Chen G, Gao F, Xu R, Li N, Zhang Y, Li YJTPC (2019) Transcriptional repression of the APC/C activator genes CCS52A1/A2 by the mediator complex subunit MED16 controls endoreduplication and cell growth in Arabidopsis. Plant Cell 31:1899–1912. https://doi.org/10.1105/tpc.18.00811
Ma Z, Zhu P, Shi H, Guo L, Zhang Q, Chen Y, Chen S, Zhang Z, Peng J, Chen J (2019) PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature 568:259–263. https://doi.org/10.1038/s41586-019-1057-y
Mathur S, Vyas S, Kapoor S, Tyagi AK (2011) The Mediator complex in plants: structure, phylogeny, and expression profiling of representative genes in a dicot (Arabidopsis) and a monocot (rice) during reproduction and abiotic stress. Plant Physiol 157:1609–1627. https://doi.org/10.1104/pp.111.188300
Myers LC, Gustafsson CM, Bushnell DA, Lui M, Erdjument-Bromage H, Tempst P, Kornberg RD (1998) The med proteins of yeast and their function through the RNA polymerase II carboxy-terminal domain. Genes Dev 12(1):45–54. https://doi.org/10.1101/gad.12.1.45
Näär AM, Taatjes DJ, Zhai W, Nogales E, Tjian R (2002) Human CRSP interacts with RNA polymerase II CTD and adopts a specific CTD-bound conformation. Genes Dev 16:1339–1344. https://doi.org/10.1101/gad.987602
Nakayama A, Fukushima S, Goto S, Matsushita A, Shimono M, Sugano S, Jiang CJ, Akagi A, Yamazaki M, Inoue H, Takatsuji H (2013) Genome-wide identification of WRKY45-regulated genes that mediate benzothiadiazole-induced defense responses in rice. BMC Plant Biol 13:150. https://doi.org/10.1186/1471-2229-13-150
Paxton JDJPD (1980) A new working definition of the term “phytoalexin.” Plant Dis 64:734
Ren Y, Tian X, Li S, Mei E, He M, Tang J, Xu M, Li X, Wang Z, Li C, Bu Q (2020) Oryza sativa mediator subunit OsMED25 interacts with OsBZR1 to regulate brassinosteroid signaling and plant architecture in rice. J Integr Plant Biol 62:793–811. https://doi.org/10.1111/jipb.12914
Saleh D, Milazzo J, Adreit H, Fournier E, Tharreau D (2014) South-East Asia is the center of origin, diversity and dispersion of the rice blast fungus, Magnaporthe oryzae. New Phytol 201:1440–1456. https://doi.org/10.1111/nph.12627
Schmelz EA, Huffaker A, Sims JW, Christensen SA, Lu X, Okada K, Peters RJ (2014) Biosynthesis, elicitation and roles of monocot terpenoid phytoalexins. Plant J 79:659–678. https://doi.org/10.1111/tpj.12436
Sekido H, Endo T, Suga R, Kodama O, Akatsuka T, Kono Y, Takeuchi SJJOPS (1986) Oryzalexin D (3, 7-Dihydroxy-(+)-sandaracopimaradiene), a new phytoalexin isolated from blast-infected rice leaves. J Pestic Sci 11:369–372. https://doi.org/10.1584/jpestics.11.369
Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji HJPC (2007) Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance. J Pestic Sci 19:2064–2076. https://doi.org/10.1584/jpestics.11.369
Swaminathan S, Morrone D, Wang Q, Peters FRJJPC (2009) CYP76M7 Is an ent-Cassadiene C11α-hydroxylase defining a second multifunctional diterpenoid biosynthetic gene cluster in rice. Plant Cell 21:3315–3325. https://doi.org/10.1105/tpc.108.063677
Tadami A, Osamu K, Haruchika S, Yoshiki K, Setsuo TJA, Chemistry B (1985) Novel phytoalexins (oryzalexins A, B and C) isolated from rice blast leaves infected with Pyricularia oryzae. Part I: isolation, characterization and biological activities of oryzalexins. Agric Biol Chem 49:1689–1701. https://doi.org/10.1080/00021369.1985.10866951
Wang Q, Hillwig ML, Wu Y, Peters RJJPP (2012) CYP701A8: a rice ent-kaurene oxidase paralog diverted to more specialized diterpenoid metabolism. Plant Physiol 158:1418–1425. https://doi.org/10.1104/pp.111.187518
Wang C, Du X, Mou Z (2016) The mediator complex subunits MED14, MED15, and MED16 are involved in defense signaling crosstalk in Arabidopsis. Front Plant Sci 7:1947. https://doi.org/10.3389/fpls.2016.01947
Wang S, Han S, Zhou X, Zhao C, Guo L, Zhang J, Liu F, Huo Q, Zhao W, Guo Z, Chen X (2023) Phosphorylation and ubiquitination of OsWRKY31 are integral to OsMKK10-2-mediated defense responses in rice. Plant Cell 35:2391–2412. https://doi.org/10.1093/plcell/koad064
Wathugala DL, Richards SA, Knight H, Knight MR (2011) OsSFR6 is a functional rice orthologue of SENSITIVE TO FREEZING-6 and can act as a regulator of COR gene expression, osmotic stress and freezing tolerance in Arabidopsis. New Phytol 191:984–995. https://doi.org/10.1111/j.1469-8137.2011.03759.x
Wathugala DL, Hemsley PA, Moffat CS, Cremelie P, Knight MR, Knight H (2012) The mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways. New Phytol 195:217–230. https://doi.org/10.1111/j.1469-8137.2012.04138.x
Wu Y, Hillwig ML, Wang Q, Peters RJ (2011) Parsing a multifunctional biosynthetic gene cluster from rice: Biochemical characterization of CYP71Z6 & 7. FEBS Lett 585:3446–3451. https://doi.org/10.1016/j.febslet.2011.09.038
Xie K, Minkenberg B, Yang Y (2015) Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci U S A 112:3570–3575. https://doi.org/10.1073/pnas.1420294112
Yamamura C, Mizutani E, Okada K, Nakagawa H, Fukushima S, Tanaka A, Maeda S, Kamakura T, Yamane H, Takatsuji H, Mori M (2015) Diterpenoid phytoalexin factor, a bHLH transcription factor, plays a central role in the biosynthesis of diterpenoid phytoalexins in rice. Plant J 84:1100–1113. https://doi.org/10.1111/tpj.13065
Yamane HJB (2013) Biosynthesis of phytoalexins and regulatory mechanisms of it in rice. Biosci Biotechnol Biochem 77:1141–1148. https://doi.org/10.1271/bbb.130109
Yuan M, Chu Z, Li X, Xu C, Wang S (2010) The bacterial pathogen Xanthomonas oryzae overcomes rice defenses by regulating host copper redistribution. Plant Cell 22:3164–3176. https://doi.org/10.1105/tpc.110.078022
Zhai Q, Li CJJOEB (2019) The plant mediator complex and its role in jasmonate signaling. J Exp Bot 70:3415–3424. https://doi.org/10.1093/jxb/erz233
Zhang X, Wang C, Zhang Y, Sun Y, Mou Z (2012) The Arabidopsis mediator complex subunit16 positively regulates salicylate-mediated systemic acquired resistance and jasmonate/ethylene-induced defense pathways. Plant Cell 24:4294–4309. https://doi.org/10.1105/tpc.112.103317
Zhang H, Zheng D, Yin L, Song F, Jiang M (2021) Functional analysis of OsMED16 and OsMED25 in response to biotic and abiotic stresses in rice. Front Plant Sci 12:652453. https://doi.org/10.3389/fpls.2021.652453
Zhang P, Ma X, Liu L, Mao C, Hu Y, Yan B, Guo J, Liu X, Shi J, Lee GS, Pan X, Deng Y, Zhang Z, Kang Z, Qiao Y (2023) MEDIATOR SUBUNIT 16 negatively regulates rice immunity by modulating PATHOGENESIS RELATED 3 activity. Plant Physiol 192:1132–1150. https://doi.org/10.1093/plphys/kiad120
Zhang X, Yao J, Zhang Y, Sun Y, Mou ZJTPJ (2013) The Arabidopsis Mediator complex subunits MED14/SWP and MED16/SFR6/IEN1 differentially regulate defense gene expression in plant immune responses. Plant J. https://doi.org/10.1111/tpj.12216
Zhao L, Peng T, Chen CY, Ji R, Gu D, Li T, Zhang D, Tu YT, Wu K, Liu X (2019) HY5 interacts with the histone deacetylase HDA15 to repress hypocotyl cell elongation in photomorphogenesis. Plant Physiol 180:1450–1466. https://doi.org/10.1104/pp.19.00055
Zhu Y, Schluttenhoffer CM, Wang P, Fu F, Thimmapuram J, Zhu JK, Lee SY, Yun DJ, Mengiste T (2014) CYCLIN-DEPENDENT KINASE8 differentially regulates plant immunity to fungal pathogens through kinase-dependent and -independent functions in Arabidopsis. Plant Cell 26:4149–4170. https://doi.org/10.1105/tpc.114.128611
Accession Numbers
The data for the sequences in this paper are available in the Rice Annotation Project database (https://rapdb.dna.affrc.go.jp/) or GenBank databases under the following accession numbers: OsMED16, Os10g0498700 (with 1-131 aa truncated at N termination); OsWRKY45, Os05g0322900; OsWRKY62, Os09g0417800.
Funding
This work was supported by Wuhan Science and Technology Major Project on Key techniques of biological breeding and Breeding of new varieties (2022021302024851), the National Natural Science Foundation of China (32001525), Major Projects of Technological Innovation in Hubei Province (2021BBA224).
Author information
Authors and Affiliations
Contributions
XD, FS, and QH considered the project and designed the study; YW, and QH carried out the majority of the experiments and pictures; YW, QH performed analyzed data; YW, YF, and ZZ, generated some transgenic plants; We thank JH for providing M. oryzae Guy11. We are grateful to KX for providing the pRGEB32 vector.
Corresponding authors
Ethics declarations
Ethics Approval and Consent to Participate
Not applicable.
Consent for Publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1
. Fig. S1. The homozygous of CRISPR/cas9 edited OsMED16 plants caused seedling lethality. Fig. S2. Phylogenetic tree of MED16 proteins. Fig. S3. Mapping of the pU1301-1-CaMV35S-OsMED16-Flag overexpression vector. Fig. S4. Mapping of CRISPR/Cas9-Osmed16 knockout vectors. Fig.S5. Diagram of Pbait-ABAi-Pro.CYP99A3, Pbait-ABAi-ProKSL10, Pbait-ABAi-Pro.DPF vector construction. Fig. S6. Screening assay for optimal concentrations to suppress bait reporter strains. Fig. S7. Diagram of carrier modification for pGreen II 62-SK. Fig. S8. OsMED16 positively regulates rice resistance to rice blast via modulating H2O2 biosynthesis. Fig. S9. The analysis and cloning of promoters of H2O2 synthesis and degradation-related genes. Fig. S10. The H2O2 synthesis and degradation-related genes promoter activation were not dependent on the OsMED16-OSWRKY45 pathway. Fig. S11. OsMED16 not interacting with Pro.CYP99A3, Pro.KSL10, Pro.DPF. Fig. S12. Analysis of the effects of OsWRKY45+OsWRKY62 and OsWRKY45+OsWRKY62+OsMED16 on proOsCYP99A3, proOsKSL10 and proOsDPF. Fig. S13 Analysis of effects of Ev, OsWRKY45, OsMED16+OsWRKY45 and OsMED16+OsWRKY45/OsWRKY62 on proOsCYP99A3, proOsKSL10 and proOsDPF, respectively, detected in one leaf.
Additional file 2
. Table S1. Primer used in this study.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Wu, Y., Fu, Y., Zhu, Z. et al. The Mediator Subunit OsMED16 Interacts with the WRKY Transcription Factor OsWRKY45 to Enhance Rice Resistance Against Magnaporthe oryzae. Rice 17, 23 (2024). https://doi.org/10.1186/s12284-024-00698-9
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12284-024-00698-9