Skip to main content

Table 1 The putative off-target event in the osspl4 mutant lines

From: The Elite Alleles of OsSPL4 Regulate Grain Size and Increase Grain Yield in Rice

Target site Putative off-target site Sequence of putative off-target site Region No. of plants No. of plants with mutations Mutation rate (%)
OsSPL4-OFF1 Chr7:19100187-19100209 AGGTGCCAGGTGGAGAGGTGCGG CDS 10 2 20%
OsSPL4-OFF2 Chr8:25274878-25274900 CGGTGCCAGGTGGAGGGGTGCGG CDS 10 1 10%
OsSPL4-OFF3 Chr9:18918476-18918498 AGGTGCCAGGTGGAGGGTTGCGG CDS 10 0 0
OsSPL4-OFF4 Chr8:167437-167459 TGGTGCTAGGAGGAAGGGTTTGG Intergenic 10 0 0
OsSPL4-OFF5 Chr9:16055179-16055201 AGAGGCCTGGTGGAAAGGTGAGG Intron 10 0 0
OsSPL4-OFF6 Chr1:18039404-18039426 AAGCGCCATGTGGAGGGGTGTGG Intergenic 10 0 0
  1. The bold font represents the PAM motif (NGG), the italics font indicates the mismatch bases