Skip to main content

Table 2 Primers for qRT-PCR

From: OsGATA16, a GATA Transcription Factor, Confers Cold Tolerance by Repressing OsWRKY45–1 at the Seedling Stage in Rice

Gene ID Name Forward primer Reverse primer
LOC_Os12g44350 Actin CCTGGCAGTATGAAGGTAGTTG GAAGCACTTCATGTGGACGAT
LOC_Os06g37450 OsGATA16 TGCTTGAGCCCCAAAATATG GCAGCTTCTCGGTATCGTAT
LOC_Os01g10840 OsGSK1 ACGGGTCACATCATCTCC AGTTCCTACAACTCGCTCC
LOC_Os03g08570 OsPDS ACTGGCTGCCTGTCATCT TACTTGCGAAGCACCTAT
LOC_Os05g25770 OsWRKY45–1 GCAGCAATCGTCCGGGAATT GCCTTTGGGTGCTTGGAGTTT
LOC_Os05g49890 OsRAN2 TGGTGGACTTAGGGATGG GGAATGTGACCTGCTTGG
LOC_Os02g10920 OsSRZ1 ATGAACAGGAAGCCAGGAGACT TCCACCGAAGGAGGAACCA
LOC_Os01g55940 OsGH3–2 GAAGATGAGCTGGACAGGAGGC GGGCGGTGCTTGAAGTGAT
LOC_Os06g45140 OsbZIP52 GCGAATAAGAAGGATGGTGTC GCTTGAAGAGGGATGAGTTTT
LOC_Os03g22680 OsSRFP1 ATTCGGCAGGATGGGATT TCGTGGACTCGTTGTGGC
LOC_Os09g02270 OsCYL4 GACCTCGCCATCCTCAAC AACTCGCCGAACTCCTTT
LOC_Os02g10200 OsZFP185 CCAAGTGCCACAAGGAGAT CCCACCGTCACAACCATT
LOC_Os02g41510 OsMYB30 ACAACACCACGGACAGTTTCAC CCGTCATTGCCAGCGTCT
LOC_Os07g05720 OsTCP21 CACGCGGAGATGACGCACTA ACCCACAAGACCCGAGGACA
LOC_Os01g11550 OsPCF5 TCCAGAGCTACACGCCTGACC ATGGCGATGTTGCTGGTGG
LOC_Os03g57190 OsTCP8 CATGTCCTCGGGTTTCTTGGG GCTGCTGCTGATGGTGGTGG
LOC_Os10g28600 OsTCD10 GCCTGGTTTATTTCCTTG GTCTCGACATCCCTCCTC
LOC_Os12g42190 OsPCF8 CCGTCGCTCGACTGCTCCTT GGCTTGCTGCCGTTGGTGTT