Skip to main content

Table 3 Details of nks_bad2 gene based SSR marker for aroma

From: Marker Assisted Development and Characterization of Herbicide Tolerant Near Isogenic Lines of a Mega Basmati Rice Variety, “Pusa Basmati 1121”

Marker Primer Sequences Tm PB1121 Allele Robin Allele Position (Mb)
nks_bad2 F: GGTTGCATTTACTGGGAGTTATG 58 °C 82 bp 90 bp Gene based