Skip to main content

Table 1 Details of SSR marker linked to the AHAS gene which was used in foreground selection

From: Marker Assisted Development and Characterization of Herbicide Tolerant Near Isogenic Lines of a Mega Basmati Rice Variety, “Pusa Basmati 1121”

Marker Primer Sequences Tm PB 1121 Allele Robin Allele Position
RM6844 F: AGTCCAAGAAAGGCACGAGAGG 58 °C 140 bp 200 bp 1.2 cM
R: CTGCATCGAAGAAGAAGAAGAAGC
\