Fig. 4
From: Dissection of the Genetic Architecture of Rice Tillering using a Genome-wide Association Study
Sequence analysis of the candidate gene Os07g28890 in the rice accessions with extremely low and high TNs. Tilted numbers at the top indicate the position related to the initiation codon of ‘ATG’; ‘-’ indicates upstream of ‘ATG’; ‘+’ indicates downstream of ‘ATG’; “#” is a synonymous mutation. The middle panel shows the sequence variation in the extreme low and high TN accessions. . ‘A’, ‘T’, ‘G’ and ‘C’ in the table are the four bases. ‘--’ indicates that the sequences are the same as the reference genome. ‘I1’ and ‘I2’ represent insertion of ‘AGCTAGCTAGCT’ and ‘ATGCATCCATATATCATGATCTAGCAGGTATCATTATACTCTACATATTGTCAATTTTTTTCAGAATTTTTCACAACTATTTGCATCGAATTTGGAAGAAAAAGGTATACTAGGGGATATCCCCTCGAGGGATTAGAATCCACTCCCTTTCTAAATTAATGTACTATTTGATTATTGTTTTATTCAAAAA’ mutations, respectively. The bottom panel is the LD-decay of the TN variation in the region. The LD values are included in the blocks with different colors