Fig. 3
From: Dissection of the Genetic Architecture of Rice Tillering using a Genome-wide Association Study
Sequence analysis of the candidate gene Os01g28690 in the rice accessions with extremely low and high TNs. Tilted numbers at the top represent the position related to the initiation codon of ‘ATG’; ‘-’ indicates upstream of ‘ATG’; ‘+’ indicates downstream of ‘ATG’; “#” is a synonymous mutation; “$” indicates a missense mutation from tryptophan (W) to Valine (V). Arrow shows the direction of Os01g28690; blue rectangles indicate the gene exon regions. The middle panel is the detail sequence variation among the extreme low and high TN accessions. ‘A’, ‘T’, ‘G’ and ‘C’ in the table are the bases. ‘--’ indicates that the sequence in the accessions is the same as the reference sequence, and “+C” indicates insertion of one base pare. ‘I1’, ‘I2’ and ‘I3’ represent insertion of ‘ATTACTAG’, ‘CTCGCGGA’ and ‘CCTTCG’, respectively, while ‘D1’ and ‘D2’ represent deletion of ‘ATGTTATCAATTTGACAACATGGC’ and ‘ATCT’, respectively. The bottom panel is the LD-decay of the TN variation in the region. The LD values are included in the blocks with different colors