Skip to main content

Table 5 Gene-specific polymerase chain reaction primers used for the identification of major BB resistance genes

From: Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice

Resistance gene Chr.no. Marker name Primer sequences used for gene detection Expected size (bp) Band type Reference
    Forward (5′-3′) Reverse (5′-3′)    
xa5 5 10603.T10Dw GCACTGCAACCATCAATGAATC CCTAGGAGAAACTAGCCGTCCA 280 Co-dominant Jeung et al. (Unpublished)
Xa4 11 MP1 + MP2 ATCGATCGATCTTCACGAGG TGCTATAAAAGGCATTCGG 150 Co-dominant Sun et al.2003
Xa21 11 U1/I1 CGATCGGTATAACAGCAAAAC ATAGCAACTGATTGCTTGG 1,400 Co-dominant Wang et al. 1996