Table 5 Gene-specific polymerase chain reaction primers used for the identification of major BB resistance genes
Resistance gene | Chr.no. | Marker name | Primer sequences used for gene detection | Expected size (bp) | Band type | Reference | |
|---|---|---|---|---|---|---|---|
|  |  |  | Forward (5′-3′) | Reverse (5′-3′) |  |  |  |
xa5 | 5 | 10603.T10Dw | GCACTGCAACCATCAATGAATC | CCTAGGAGAAACTAGCCGTCCA | 280 | Co-dominant | Jeung et al. (Unpublished) |
Xa4 | 11 | MP1 + MP2 | ATCGATCGATCTTCACGAGG | TGCTATAAAAGGCATTCGG | 150 | Co-dominant | Sun et al.2003 |
Xa21 | 11 | U1/I1 | CGATCGGTATAACAGCAAAAC | ATAGCAACTGATTGCTTGG | 1,400 | Co-dominant | Wang et al. 1996 |