Skip to main content

Table 2 Characteristics of the InDel markers including their chromosome locations and their annotations

From: Genetic structure of Thai rice and rice accessions obtained from the International Rice Research Institute

Genes Sequence Size Tm Position Annotation
     (Chromosome; Mb)  
1gAP006530 F: ACCCCCAGCATCTCCTCGTC 261 55 1; 15.0 intergenics
  R: ACTGGGCCAGGGCTGAGTCT     (close to OsS01g26950)
1gAP003855 F: CTTGCGCGGTCGAGTAGACG 289 55 1; 25.7 intergenics
  R: AGCGGTGTGATCCCCAAAGG     (close to Os01g45310)
Os01g48270 F: AGGCAAGCATTGGAAATAGG 210 55 1; 27.6 AAA-type ATPase family
  R: TGGTAACAATCGCACCTTGA     protein, putative, expressed
Os01g57310 F: CGATGAACTGGAACACCATGA 290 57 1; 33.1 rp1-like protein, putative, expressed
  R: GGCAACAGAGCCATACTTTGA     
Os01g72550 F: CCG AGT TCA GGC GAG TGT TC 382 55 1; 42.4 OsCML19-Calmodulin-
  R: TCA TTG TTT GGC ACT CCT CG     Related calcium sensor protein
Os02g48500 F: AGGCAATGGAGCACCAAGTT 277 57 2; 29.6 hypothetical protein
  R:TTGTACTGTTGGGGTTGGCA     
Os04g22440 F: ATCCTCGATGACACCGACCT 352 57 4; 12.6 hypothetical protein
  R: TGCCCTTGGTAACTTGCTTCT     
Os04g30430 F: GCTTCTCCTGGTTGTATGC 163 52 4: 18.0 nuclear transport factor 2,
  R:AAAATAGGGAGGCAGATAGAC     putative, expressed
4gAL606639 F: TTTTGTGAAACTTGACCCTC 112 52 4; 28.8 intergenics
  R: GCGTCCATGTCTTTATTGTG     (close to OS04g48750)
5gAC137622 F: CTCGCTGTTTACTGACTGG 155 52 5; 13.8 intergenics
  R: TTTGATGTACTGCCTGCTCT     
Os06g11600 F: TGCTGTGGGGCCTCTAATGA 211 55 6; 6.1 growth regulator related
  R: TGAGACAACACCCACCCACC     protein, putative, expressed
Os06g51110 F: GAT GGC AAA CAC CAA CAG GA 340 55 6; 30.9 cyclin, putative,
  R: GAG GGT TGG TTT GCC AGT GT     expressed
Os07g26740 F: GGGGAAGCGTCGTTATGACC 259 55 7; 15.4 60 S ribosomal protein L44,
  R: CCTTGATCGGGTGCTGAGAG     putative, expressed
Os07g027000 F: GCGCACTGTGATGCAAGATG 358 55 7; 15.6 retrotransposon protein
  R: GACCTTGTCGGGATGTGCAG     putative, unclassified
Os07g27590 F: CTGTTGAAGGGGAGGAGCGT 244 55 7;16.1 retrotransposon protein,
  R: TACGGTGCACTTCGGTCGTC     putative, unclassified
Os08g41690 F: TGCGAGGATGGAGTTCTTGA 250 55 8; 26.3 expressed protein
  R: CAATCCCTTCACCAGAAGGAC     
Os08g41950 F: GTC AGC CTG AAG TGC AGC AG 418 55 8; 26.5 OsMADS7 - MADS-box
  R: CGG CAC CAC ATA TAT GCC AC     family with MIKCc type-
      box, expressed
Os09g08960 F: GGACTGAAAACACGATCGCA 280 55 9; 4.7 retrotransposon protein,
  R: TTTTGGGGATCATCATCGACT     putative, unclassified
Os11g41390 F: AAGAAAAATATCTATTGAGGAGTG 178 52 11; 24.3 hypothetical protein
  R: GGAGGACCATAAATGACGG