Skip to main content

Table 2 Primer sequences and locations of the indel markers designed for this study

From: Chromosomal Location of HWA1 and HWA2, Complementary Hybrid Weakness Genes in Rice

    Location on IRGSP pseudomolecules Build05  
Marker name   Primer sequences (5′–3′) Chromosome Position Source of DNA polymorphism information
From To
KGR1M47 F CACAAATAGAATTACTGATGAAACCTT 1 38529588 38529747 Shen et al. 2004
R CGTTACCGCTTATGTAGAGTCATC
KGR2M10 F CATACATGGATGTCTAGTCGAAGA 2 6465517 6465683 Shen et al. 2004
R CAGTTCCAGTAAGTACATGGGTTT
KGS0328 F ATCTAGCAAAATTATTCGAGCAGAA 3 31067890 31068058 Monna et al. 2006
R ACTTTACAGTAACAAGGGGTGCAA
KGR4M30 F CAAAATAGGGAGGCAGATAGACA 4 18395635 18395794 Shen et al. 2004
R CTCCTGGTTGTATGCTCGTAAAT
KGS0049 F AAATTATACTTCCAATCAAGCATCAAG 4 22809557 22809823 Monna et al. 2006
R AATTGTATTGGATTGGAGCTGGT
KGR4M43 F GAGGTTATCCTCCCTAACACCAG 4 25116441 25116556 Shen et al. 2004
R TGCCAAATACAATATGACCACAA
KGS0051 F CGAAAACAGTTAGGTGTTTGTTAGG 4 35483948 35484104 Monna et al. 2006
R CTTACATGTAGTACAAACAACCCACA
KGS0494 F GATGGCTAGCTTGACTCCTGAATA 6 22083785 22084001 Monna et al. 2006
R CTCTAGGATACAATCATGGCAAACT
KGS0135 F ACCTCATTTTATTTCAACATTGCAG 8 6028192 6028300 Monna et al. 2006
R CTTCCTGACCAAGTTAAACCCCTA
KGR8M46 F CGAATAATTTGTAGCCGAGAAAA 8 28228891 28229086 Shen et al. 2004
R GCAGAGTCCAGAGAAGATCCAT
KGR10M40 F CGTTTAATTTACGTGCGAATAGG 10 19966648 19966807 Shen et al. 2004
R AACCTGAGGCACTAGTTCGTTATC
KGS0342 F ATACACACAGCAGACATAAGGTGAT 10 14305320 14305584 Monna et al. 2006
R AATAACCGTTTGATTGGACTAAAAA
KGS0185 F TGACTACAGAAATAGTGCAGCTTCT 11 24091407 24091582 Monna et al. 2006
R CCCCCTCCTTGACTTTGG
KGC11M1 F GGCAGGAGAGGAGAAACTGA 11 25263891 25263963 This study
R GAAGAAAGTGACCATGGATGAA
KGS1797 F AGTGGTGAGCTGCTAACAAATCTCT 11 29167452 29167572 Monna et al. 2006
R GCCGAGCGAGCTGAGTATC
KGS1739 F AGAGACGCAGGAGCTGCTTA 12 1999528 1999818 Monna et al. 2006
R CATGACCCTTCTATGGCAATTAT