Skip to main content

Table 4 Primer Sequences of SNAP Markers within Sorghum Genes

From: Molecular Markers for Sweet Sorghum Based on Microarray Expression Data

S. bicolor gene ID Allele WebSNAPER primer sequence PCR product size (bp) Allele presencea
Sb01g043060 T F: GTAATATACTGACGCCAAAAGAGGCGGATT 306 BT
  R: TCAACTGCTGTTGTCGAGGACATTGG   
A F: TGTAATATACTGACGCCAAAAGAGGCGACTT 307 Ri-Top
  R: TCAACTGCTGTTGTCGAGGACATTGG   
Sb01g044810 C F: CAATCCTGCTCCCCAATCCAGACC 334 BT-Da-De-Sim
  R: GATTACGAGATCAGCGGTCTGGAAAGAAA   
T F: GCAATCCTGCTCCCCAATCCAGACT 335 Ri-He-IS-SC-M81
  R: GATTACGAGATCAGCGGTCTGGAAAGAAA   Top
Sb02g000780 A F: TGGAGCAATACGAGGGCTACTCCAAA 118 BT
  R: AATCTTCAGAAACGCTCCATTTGTGCTG   
G F: TGGAGCAATACGAGGGCTACTCCATG 118 Ri-He-IS-SC-Da-De
  R: AATCTTCAGAAACGCTCCATTTGTGCTG   M81-Top-Sim
Sb02g006330 G F: TGTGGTACAGGTACACAAGCGAGAACATG 115 BT-IS-Da-De-M81
  R: CCTTACAGGCATAACGAGTATGAGAGATTCATAACA   
A F: CTTATTTGTGGTACAGGTACACAAGCGAGAATAAA 121 Ri-Top-Sim
  R: CCTTACAGGCATAACGAGTATGAGAGATTCATAACA   
Sb03g012420 C F: GAAGCATTCTTTCCGATACAATATGGCCTATC 164 BT-He-SC-M81-Top
  R: TTCGATTAAAGGATTGTTGATGAAACTAGGGG   Sim
T F: GAAGCATTCTTTCCGATACAATATGGCCTACT 164 Ri-IS-Da
  R: TTCGATTAAAGGATTGTTGATGAAACTAGGGG   
Sb03g007840 C F: CCATAAATGTCATTGTGGAGACATCCGTTC 161 BT-He-IS-SC-M81
  R: TGGAACGTCAAAACATTGACCGGAA   Top
T F: AAATGTCATTGTGGAGACATCCGGGT 157 Ri-Da-Sim
  R: TGGAACGTCAAAACATTGACCGGAA   
Sb03g027710 T F: GGTCATCGGTGATGGTGGAGAACCT 343 BT
  R: GGGAATTCGATTATGTCCATCACACCC   
G F: AGGTCATCGGTGATGGTGGAGATCTG 344 Ri-Da-Sim
  R: GGGAATTCGATTATGTCCATCACACCC   
Sb03g039090 C F: CGAACCCAACAACCTGTAACAATAAGCACTAC 326 BT-Da-De-Top-Sim
  R: GGAATTCGATTATCTCGGGGCTCATCTAC   
A F: GAACCCAACAACCTGTAACAATAAGCAGAAA 325 Ri-M81
  R: GGAATTCGATTATCTCGGGGCTCATCTAC   
Sb04g0037170 G F: CACAAGCGACTTGAAACTGCGCTG 131 BT-IS-SC-Top
  R: GGCTTGACAACTGCTTCAACCTCTGC   
C F: CACAAGCGACTTGAAACTGCACCC 131 Ri-He-Da-De-M81
  R: GGCTTGACAACTGCTTCAACCTCTGC   Sim
Sb07g005930 T F: CAGTTCTCCAATCCTTTCCTCTGTGGTCT 146 BT-He-SC-Da-M81
  R: GTGAGAAGCGTGGGATGCTCATCAG   
G F: GTTCTCCAATCCTTTCCTCTGTGGTCG 144 Ri-IS-Top-Sim
  R: GTGAGAAGCGTGGGATGCTCATCAG   
Sb08g020760 C F: CAGAGGAAGCCCTTACACAGATCCGAC 1,400 BT-M81
  R: TACCCACAGGTCTGGAAAGGGCAAG   
T F: CAGAGGAAGCCCTTACACAGATCCGAT 416 Ri-He-IS-SC-Top
  R: TACCCACAGGTCTGGAAAGGGCAAG   Sim
Sb08g008320 T F: GCAGTGGAAGGACATCATTGCCCAT 174 BT-He-Da-M81-Sim
  R: CTCTTCCGGGACGCGACGTTC   
C F: CAGTGGAAGGACATCATTGCCGTC 173 Ri-IS-SC-Top
  R: CTCTTCCGGGACGCGACGTTC   
Sb09g005280 A F: GCAGCACCGTCACCGGCACTA 142 BT
  R: GAGGCTCAATCAAGATCGTCTGCCC   
G F: CAGCACCGTCACCGGCATCG 141 Ri-He-IS-SC-Da-De
  R: GAGGCTCAATCAAGATCGTCTGCCC   M81-Top-Sim
Sb09g029170 C F: CTACTCTGAGATCATCAACGAGAGCGTGAAC 124 BT-He-SC-IS
  R: CCTAGATCCCAGGCGAGCCGTC   
T F: CTACTCTGAGATCATCAACGAGAGCGTGTTT 124 RI-Da-De-M81-Top
  R: CCTAGATCCCAGGCGAGCCGTC   Sim
Sb09g000820 G F: TCGAGAGCGATGCCTTCTGACATTG   
  R: CCATATCTCCAGCCATCTTCAATGTTGTG 128 BT-Top
A F: CGAGAGCGATGCCTTCTGACAGCA 130 Ri
  R: CCATATCTCCAGCCATCTTCAATGTTGTG   
Sb09g006050 C F: ATAGAAGGCAGAATGAACGCTGGAAAGC 105 BT-Top
  R: GGGCAAGCAGGCCTGGAACTTC   
A F: AGAAGGCAGAATGAACGCTGGACTGA 103 Ri-He-IS-SC-Da-De
  R: GGGCAAGCAGGCCTGGAACTTC   M81-Sim
Sb10g007380 T F: GAACTACAGACATGCACAAGGATAGCAGGTT 561 BT-Top
  R: ATTGCATTCAGGAAGCTCGCTCGA   
C F: GAACTACAGACATGCACAAGGATAGCAGAGC 561 Ri-He-IS-SC-Da-De
  R: ATTGCATTCAGGAAGCTCGCTCGA   M81
Sb10g002230 G F: CTTCAATCCGACAACCAAGTCGCTG 197 BT-He-IS-Top
  R: CTGGAACTGCAATGCGGCCATT   
A F: GCTTCAATCCGACAACCAAGTCGCTA 197 Ri-SC-Da-De-M81
  R: CTGGAACTGCAATGCGGCCATT   Sim
  1. BT BTx623, Ri Rio, He Heilong, IS IS 9738C, SC SC 1063C, Da Dale, De Della, M81 M81-E, Top Top76-6, Sim Simon
  2. aOnly the cultivars that gave a PCR product were scored. If a cultivar was heterozygous for a particular allele, it was not scored