Skip to main content

Table 3 Primer Sequences Designed and Used for Fine Mapping of the HWC2 Locus

From: Fine Mapping of HWC2, a Complementary Hybrid Weakness Gene, and Haplotype Analysis Around the Locus in Rice

Marker Kind of DNA marker (restriction enzyme) Primer sequence(5′–3′) Position in Nipponbare chromosome 4 (AP008210) Source
From To
C11112 STS F CCAGCAACAGGGGATGAAGC 30325704 30325548 RGPa
R CAGGCATAAAACGGAGTGGC
RM5503 SSR F GGGAAGAAGATAGGAGATGG 30397622 30397822 McCouch et al. 2002
R CTCTGGGTACACTTCACGAG
RM1250 SSR F GAAACCACGACTAGGCATCG 31296033 31296199 McCouch et al. 2002
R CTTCCACAAGGTCTCGCTTC
0093No3 CAPS (RsaI) F TGTCCCATATCCTCCTTCAC 31335526 31335717 This study
R ACATGGCACACTAGGCTCAC
93*14.1 dCAPS (HindIII) F CTTTGTCTCTCTTTTTCTTCCACTAAG 31412533 31412724 This study
R AGTGCAAAAGTATTTCCGTG
174*4D STS F CCGCATGCGCCAAGAAATCC 31465900 31466061 This study
R TCACGGCGCCACCACACGAC
d54950 STS F CCATCATGCTGAACAAGCTCATTGGAT 31477258 31477426 This study
R TACTCCATCGTGTCCGTGTC
RM3687 SSR F CTCCTGAGAAGTGGGGACTG 31517541 31517704 McCouch et al. 2002
R AGTCCTCCATGCATGTGACC
KGC4M1 STS F CCGATCAGGTGACCAAACTT 31533990 31534079 This study
R GATGCATTGACCATGGAAGA
KGC4M2 STS F AACGGATCTGGATAGGACCA 31536677 31536812 This study
R GGAGTTGTCTTCTTCCACTGC
C174*12 CAPS (RsaI) F CCTTTGCTGGTGTCAAGTCA 31543923 31544160 This study
R ACTGGTGCTTCCTGGTCCTA
KGC4M3 STS F TGTTGAAATAAGACGGCTTGG 31559019 31559107 This study
R CGTTAGCTTCGCTTTCAGTG
dG264H dCAPS (HindIII) F ACCAGGAGATGACAACACAG 31560681 31560890 This study
R ATCCGCTCCAAATCAGCAAAGCT
C174*15 CAPS (MboII) F CAGTGGGCTTGTGGGTAAGT 31572635 31572793 This study
R GCACAGCACAGTCAAAGTGG
111*1 dCAPS (HindIII) F AGAGATGTTAGCAATTTCAATG 31588152 331588361 This study
R CTGTTCCTATCATTTGTGCAACCAAG
KGC4M5 STS F AATCCCATCGCCCTTGTT 31611674 31611742 This study
R CTGCTGCTGCGGAGACAC
C111*4 CAPS (MboII) F TTGGGAGGAAAATAGCTAAGGA 31627739 31627938 This study
R TTGCTGTAAGTGGCTGGGTA
KGC4M10 STS F AATTGATTACTGGATGGCTTGATAA 31630713 31631087 This study
R GGAAGTAGACGAAATCGATGGTAT
KGC4M20 STS F ACGAGGCGATGTGTCATGT 31644658 31644749 This study
R GCCAGTCCAAACGAACACTTAT
C111*8 CAPS (MboII) F GTCAGCAGACAACCAGGTGA 31668298 31668529 This study
R CAGCATTATGGTTGAGCATG
KGC4M21 STS F CGGAAGGTCAAAATTAATCAGAG 31678330 31696684 This study
R ACAGCAATCATCCTTTTCAGTAGAT
KGC4M8 STS F TGCCTTTTGCTTACCACTGA 31690516 31690609 This study
R AGATCCGGCGGAAGAGAA
KGC4M28 CAPS (HindIII) F GTATGCAAGATGTATCCATTTTTGTGTC 31690926 31691142 This study
R CATTTTCTTCTTCAGTGATATCAAAGTGC
KGC4M29 CAPS (RsaI) F CAATCACTTGAGGAACTTTACATCCA 31695274 31695409 This study
R AAGAATGGAGCTGCAGAGACACTAAAT
KGC4M23 CAPS (HpaI) F GTGGTTGGGATCGGAATTG 31699144 31699571 This study
R TCACTACCGTTATATGTTCACGAAT
KGC4M30 dCAPS (PstI) F CAATATAAATGTTGTTTTGTAAGCATTCTA 31701502 31701604 This study
R TCTTTACTAAATATATCGTTTTTCTTCTGC
IBA44 STS F CTGGACGATATCCACGAACC 31704500 31704669 This study
R TGGGACCAGGTAGGACTTTG
KGC4M31 dCAPS (HpaI) F GCCCTTAGTGTCATAGAGAGCATAA 31705085 31705215 This study
R TGTTTGATCATGACCTTGAGAGTT
KGC4M27 STS F TGTGTGATACAATAACACCCAATG 31709144 31709269 This study
R ACCTAGTTAAATTCCAACGTCCAA
RM5473 SSR F ACACGGAGATAAGACACGAG 31710458 31710562 McCouch et al. 2002
R CGAGATTAACGTCGTCCTC
KGC4M18 STS F TGCTTGTGAAAAAGAGGGAAT 31716481 31716558 This study
R GCTGTGAACAGACCATAGTATTGAA
RM3843 SSR F ACCCTACTCCCAACAGTCCC 31717543 31717696 McCouch et al. 2002
R GGGGTCGTACGCTCATGTC
S13174 STS F CGGTTGCAGTGATCGAATTG 31726177 31726399 RGP
R CCAAATTCCCTGCCAACGAC
KGC4M52 STS F GTTGTTGCGTATTCTTTGGATTC 31810027 31810150 This study
R CGCAATAATAATACAGGATAAACATAAAA
RM3836 SSR F ACTGTGGAGTACAGGTCGGC 31845478 31845603 McCouch et al. 2002
R GAAACGGAAACGAAACCCTC
C1016 CAPS (HaeIII) F CACGCTCTTTCTATGTTTCC 33352175 33352823 RGP, modified in this study
R ATTACAACCACCCCTCCTC
  1. a http://rgp.dna.affrc.go.jp/E/publicdata/caps/index.html