Skip to main content

Table 1 Primer information on the 21 functional markers targeting 14 grain size genes

From: Grain Size Selection Using Novel Functional Markers Targeting 14 Genes in Rice

Primer Names Primers sequence (5′-3′) Enzyme sites Amplicon size (Digested) bp
GW2_SNP-F AAAACCAAAACCTAACACGTGGATACAACA NspI 115 (84)
GW2_SNP-R GGCGGTGAAGATAGATGTACT
GW2_InDel-F CTCACACTGCTCAGCCTACA PstI 158 (127)
GW2_InDel-R CACGATACTCCACAGCATAACTGGGAGTCT
GS2_SNP-F GAGCGCCACATGCACCGCGGCCGCATACGT SnaBI 287 (255)
GS2_SNP-R TTGCCTGTTCCACCACCAACAGC
qLGY3_InDel-F GGGTATTCTTCTTTTCTTCCA StyI 448 (371)
qLGY3_InDel-R TGTCTGCTGCTTCATTGCT
GS3_SNP1-F CGAAGGGATCCACGCTGCCTCCAGATGATT HinfI 170 (140)
GS3_SNP1-R AGTTGCTTAAAAAGATAACGGTCAAA
GS3_SNP2-F CAAACATGAAAACCTTGTCT HaeIII 186 (155)
GS3_SNP2-R AAATAAAACGTGTGATTTAATCGTTAACGGC
GL3.1_SNP-F TGCACGATTCTATCTGGTTCAGTGGTCGA SalI 224 (193)
GL3.1_SNP-R CTAAACAAACAGGTTTTCTTAC
TGW3_SNP-F TGCACTGCCAAAATCACATATTTTGAGCCG HpaII 299 (269)
TGW3_SNP-R TCAACTACCACTAGGTCCAC
GS5_InDel-F ACTCCCATGGAATTACTAGAGAAGCCAAGC AluI 262 (205/172)
GS5_InDel-R AGGAGAAGAAAAGGTGAAAAGT
GW5_InDel-F TGCGTCGGTCGTTGGAGG   419/1631
GW5_InDel-R GCGAGCGAGCGTGTGTAGG
GS6_InDel-F TCTTCTTCCCTTCCCTTCCAC   113/125
GS6_InDel-R TGCCTCACCATTACCACTCCT
TGW6_InDel-F AGCCCCAGCTACACGAAAAACAAGTGCCCG HpaII 154 (104/72)
TGW6_InDel-R GACCAACTCGCATCAATCCC
TGW6_SNP-F ATGCGAGTTGGTCCAAAAGG SacI 296 (266)
TGW6_SNP-R GCAACGATCAGATGTGTTCGGTCAGAGCT
GW6a_InDel1-F TGCACCTCTCTCGTGTTTCT BclI 147 (117)
GW6a_InDel1-R TTATTTTCGTTCAATTTTTCTATGGCTGAT
GW6a_InDel2-F ATTACTCTTGATTTTTGTCTGTT   186/161
GW6a_InDel2-R GAGTTTGCATGTTCGTTCT
GLW7_InDel-F CTCGAGCTCGAGCTCATG   107/101/98
GLW7_InDel-R TCCCTTTCAACCTTTTCCA
GLW7_InDel_dCaps-F CCTCCTCCTCCTCCGCCTTCCACTTCGACT HinfI 133 (101)
GLW7_InDel_dCaps-R TGCTACTGTGTGCTGTGTGCT
GL7_Dup-F GATGAGCTGACAAGAGCAAAG   0/314
GL7_Dup-R AGAGGATGGGGATGAAAGAAT
GL7_InDel1-F CAGCTCACGCACATCCAAC   112/101
GL7_InDel1-R ACCATACCACATCTCATCTCAC
GL7_InDel2-F GGACGCGTGAGATGAGATGTG   118/100
GL7_InDel2-R CTCCCGCTTATTTCAACCCC
GW8_InDel-F GTGCGTGCGTCAACACACAG   88/98
GW8_InDel-R TGAGATCCCACTCCATGGCC