Skip to main content

Table 1 crRNA and enzymes used in the experiment

From: Comparison of CRISPR-Cas9/Cas12a Ribonucleoprotein Complexes for Genome Editing Efficiency in the Rice Phytoene Desaturase (OsPDS) Gene

NucleasecrRNA IDcrRNA sequenceaPAMGC %Length (nt)
WT Cas9 / HiFi Cas9 / Cas9 D10AcrRNA 1CGGGACAACTTCCTACTCATAGG50.0%20
Cas9 D10AcrRNA 2AGTTGCTTCAGCATGGATACTGG45.0%20
AsCas12a / LbCas12acrRNA 3CGGGACAACTTCCTACTCATATTTG47.6%21
  1. aBase repeats are underlined