Skip to main content

Table 2 Confirmation of Kbu peak sites and non-peak sites by quantitative PCR

From: Genome-wide Profiling of Histone Lysine Butyrylation Reveals its Role in the Positive Regulation of Gene Transcription in Rice

 Genomic regionForward primerReverse primerqPCR1qPCR2
Peak sitesLOC_Os01g02960GACATGGTCACTGTCCCCAGGATGCCATCTTCGTTGACGC01.23249
LOC_Os02g10180AATTACTTGCCACCGCCAGAATAGTCACCCTCCGCTTCCT01.475
LOC_Os03g06210CGCGTGTACCGACGAGAAAATGTTGCCTACGTTCTCCACC01.807216
LOC_Os04g37580TGCGTTGGGAATCAAACCCTTCATCGTGGCTGGCTTATGG01.052905
LOC_Os05g04950GGGGACATGTTGAGTGAGGGCAACAACTGGCTGGGCAATC01.030004
LOC_Os06g06410GAGCAAGGGCCCTAAGTTCGTAGGCACTCACACATTCCGC00.794
LOC_Os07g17220CAAAATTGCGAAGAACTGCCGCCAGGCTCCCATATCCCTGAA00.568885
LOC_Os08g08205GCCAGGTGAGATTAGGCCAGTTCCTGACAAATGCCTGCCA01.656729
LOC_Os09g28310TGTCCCACCCTAGAGACCAGAGCTAGTCATCAGGCAGGTTG01.656729
LOC_Os10g28254TCCGATTAGGTTGGCTATATTCATTGAAGCACTTCCACACAAGT00.382959
LOC_Os11g26130GCCACTGTGTGAACCGACTAAGGGTTGCCCTTGCGAATTA00.401704
LOC_Os12g43750TTCCAAACCAACCAACTCCCTTCCCACGAGAACATCACGGT01.184018
Non-peak sitesLOC_Os01g01320TGGTGCACAATGCTGAGACTCCAGTTTCAGAGTAGTTGATGGC0−1.34071
LOC_Os02g38870AGGAGGAAGAGGGGCCTAAGTCGTGTCCATCTCCTCGTCT0−0.1424
LOC_Os03g02650ATGGGCTTACGGGTGCATAGCCTATCTCGCATACGTGCCG00.419453
LOC_Os04g02030GAGCAAGGTCCTGGTCACAAGGCCATCAAGACTCACAGCA0−0.32465
LOC_Os05g25510TCTCAGTGGTGGGGAAGGATACCATTGCTCACCTCAAGCA0−0.57654
LOC_Os06g02930GGTCATGAAGGTCATCCACGGCCGTGATGTTGGGCAAGTAGA01.961737
LOC_Os07g37370GTGAGGGTGAGAGGGGAAAGAAATTAGCTCCCGGACTGGC00.739465
LOC_Os08g23640CAACGACATCGTGCTCGCGCGACGCCGTACCTGAAG0−0.09366
LOC_Os09g39170AACCCATCATCACGGTGGACAGAGATGGGCTGCTGGTAGA01.608844
LOC_Os10g01590ATGACCACAAAACGGTTCGGGATTGACTCGCGCTATGCAG0−0.97679
LOC_Os11g02810GGATTTCGCGATGGGGATTCAAGTGGTTCGCAACGCAATC00.866769
LOC_Os12g43220GGTGCTAGGAATCGACCCAACTGCCATCACCAAGGGGAAT0−0.68791
  1. 1Normalized C(t) of input DNA
  2. 2Normalized C(t) of ChIP DNA