Skip to main content

Table 6 Sequences of primers for Actin and sucrose transporter genes for qRT-PCR

From: The Initiation of Inferior Grain Filling is Affected by Sugar Translocation Efficiency in Large Panicle Rice

Gene Forward primer 5′ → 3’ Reverse primer 5′ → 3’
Actin CAATCGTGAGAAGATGACCC GTCCATCAGGAAGCTCGTAGC
OsSUT1 GCTTTCAACCAGGGTGTCAG ACTTTCCGGCACATTGGTTC
OsSUT2 TCTTTTATCGGTGGGCTGGT TTGCAAAGAATGGCCGACAA
OsSUT3 TTTGGAAATGTTAGGCGCCC ATAGCCTATCAGCCGTCCAC
OsSUT4 CTCGTGCCCTTTTAGCTGAC AACGTTTCCAACAGCCATCC
OsSUT5 TTCGCCTTCATCTGTGGAGT GCCTTTGATGGAGTTTCGCA