Table 2 List of SNP identified on the QBPH4.2 sliding window (15.22–17.22 Mb) on chromosome 4. SI = SNP index; QS = QBPHS; QR = QBPHR; IndS = BPHS; IndR = BPHR; AAC = amino acid change; (−) = synonymous variant; (+) = missense variant or stop codon
Position | LOC identifier | gene product name | KASP-SNP marker | SNP S/R | SI in QS | SI in QR | SI in IndS | SI in IndR | SNP pos / CDS length | SNP effect | AAC | AAC position/protein length |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
15,893,411 | LOC_Os04g26870 | oxidoreductase |  | A/G | 37.8 | 100.0 | 0.0 | 100.0 | 906/1053 | – |  |  |
15,893,519 | LOC_Os04g26870 | oxidoreductase |  | C/T | NA | NA | 0.0 | 71.4 | 1014/1053 | – |  |  |
15,916,097 | LOC_Os04g26910 | oxidoreductase |  | T/C | 40.8 | 97.3 | 0.0 | 100.0 | 255/1056 | – |  |  |
15,916,138 | LOC_Os04g26910 | oxidoreductase | R04015916138 | A/C | 42.6 | 97.1 | 0.0 | 100.0 | 410/1470 | + | E > A | 99/351 |
15,916,153 | LOC_Os04g26910 | oxidoreductase | R04015916153 | A/G | 46.2 | 1.7 | 100.0 | 0.0 | 425/1470 | + | D > G | 104/351 |
16,044,907 | LOC_Os04g27096 | expressed protein |  | G/A | 0.0 | 95.2 | 0.0 | 94.1 | 418/687 | – |  |  |
16,214,690 | LOC_Os04g27430 | sesquiterpene synthase2 | OsSTPS2_21bp_del | −/TTTATGCCTCTGGTGTGACCA | 0.0 | 100.0 | 0.0 | 100.0 | 477/1416 | + | 7-aa-ins | 313/472 |
16,380,993 | LOC_Os04g27720 | terpene synthase | R04016380993 | A/C | 100.0 | 1.7 | 100.0 | 1.7 | 1161/1518 | + | S > R | 387/505 |
16,582,690 | LOC_Os04g28090 | MYB family transcription factor |  | C/T | 0.0 | 100.0 | 0.0 | 100.0 | 621/2919 | – |  |  |
16,586,281 | LOC_Os04g28090 | MYB family transcription factor |  | G/A | 100.0 | 7.7 | 100.0 | 7.7 | 2337/2919 | – |  |  |
16,627,505 | LOC_Os04g28150 | expressed protein | R04016627505 | C/G | 0.0 | 100.0 | 0.0 | 100.0 | 795/867 | + | D > E | 265/288 |
16,632,510 | LOC_Os04g28160 | response regulator receiver domain containing protein |  | T/C | 0.0 | 100.0 | 0.0 | 100.0 | 705/1143 | – |  |  |
16,672,214 | LOC_Os04g28210 | verticillium wilt disease resistance protein | R04016672214 | T/G | 21.9 | 96.2 | 0.0 | 88.9 | 295/3775 | + | D > A | 85/1034 |
16,713,777 | LOC_Os04g28270 | expressed protein |  | C/T | 1.2 | 97.2 | 0.0 | 98.8 | 285/438 | – |  |  |
16,732,393 | LOC_Os04g28280 | BEE 3 |  | T/C | 0.0 | 97.0 | 0.0 | 97.0 | 792/792 | – |  | 264/263 |