Skip to main content

Table 1 Primers used for quantitative RT-PCR experiments

From: Physiological and molecular responses of seedlings of an upland rice (‘Tung Lu 3’) to total submergence compared to those of a submergence-tolerant lowland rice (‘FR13A’)

Gene name

Primer sequence

OsSUS1- forward

5′-catctcaggctgagactctga −3′

OsSUS1- reverse

5′- caaattcaatcgaccttactt −3′

OsADH1- forward

5′-gcaaatttctggctttgtcaatcagta −3′

OsADH1- reverse

5′-cgccaaaagatcactgattcttaacaa −3′

Osubiquitin - forward

5′-aaccagctgaggcccaaga-3’

Osubiquitin - reverse

5′-acgattgatttaaccagtccatga-3’