Skip to main content

Advertisement

Table 3 Gene-specific primers used for the real-time PCR

From: Transcriptome profiling of the spl5 mutant reveals that SPL5 has a negative role in the biosynthesis of serotonin for rice disease resistance

Gene a Accession Forward primer (5′-3′) Reverse primer (5′-3′)
AS Os03g0718000 GGCTCCTCCCCAAGATCCAGTCC TGCGTTTTCACCTTCCACCACAG
IGPS Os09g0255400 CGCCGCCTCTTCCTCTCTC GGACTTGCCGCTCTCCCAC
TS Os07g0182100 AGCTGTGGCTGTTGGGTTCGGTAT GCTTCTTCAATCCTTCTTCGGGTG
TDC Os08g0140500 TCAAGAACCACGCCAGCGACTC GTAGGTGCGCATGACCATCCAG
OsWRKY14 Os01g0730700 AGCACAACCACTCCGCCAC CCTCCTCCCATCTCCAGCC
OsPR1a Os07g0129200 TATGCTATGCTACGTGTTTATGC CACTAAGCAAATACGGCTGACA
  1. aGenBank Accession (http://www.ncbi.nlm.nih.gov/).