Skip to main content

Table 1 Markers used for foreground selection of three bacterial blight resistance genes in marker-assisted backcross breeding

From: Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna

Resistance gene Chromosome number Marker Primer sequences used for gene detection Expected size (bp) Band type reference
Forward(5’-3’) Reverse(5’-3’)
xa5 5 xa5S (Multiplex) GTCTGGAATTTGCTCGCGTTCG TGGTAAAGTAGATACCTTATCAAACTGGA 410 bp, 310 bp,180 bp STS Sundaram et al. 2011
xa5SR/R (Multiplex) AGCTCGCCATTCAAGTTCTTGAG TGACTTGGTTCTCCAAGGCTT
xa13 8 RG136 TCCCAGAAAGCTACTACAGC GCAGACTCCAGTTTGACTTC 530 bp, 490 bp STS Huang et al. 1997
Xa21 11 pTA248 AGACGCGGAAGGGTGGTTCCCGGA AGACGCGGTAATCGAAGATGAAA 1000 bp STS Huang et al. 1997