Skip to main content

Table 1 Primers used for reverse transcription-quantitative polymerase chain reaction gene expression studies

From: Meloidogyne incognita - rice (Oryza sativa) interaction: a new model system to study plant-root-knot nematode interactions in monocotyledons

Name Gene Forward Reverse primer
Mi-CRT (calreticulin) GenBank: AAL40720 GGCTCTGTTGGTATTGACATC CTTGCGTTCTTCCTCATCTGC
Mi-actin Minc06769* GCTTTGCTATGTTGCTTTGG TGTAAGAAGTCTCGTGAATACC
Mi-csq-1 Minc11275* TGATTATTTACAGGAAATGTTTGG TAGGGTCGTCTAAATTTAATTGG
Mi-eif-3C Minc06181* AAATTCTTTCGTAGTGCTGTTTC AAATCTTGTCGTCCTAATGGC
Mi-gpd-2 Minc12412a* AAGCCGTTCTTTCTTTGTATG AAGCATAACCTTCATAGATTGG
Mi-Y45F10D.4 Minc08763* CAAAGATGATCCCACAATAGG AAAGTTTTGAATTTGGCATCG
Os-actin (actin-1) RAP-DB: Os03g0718100 CTCTCAGCACATTCCAGCAG AGGAGGACGGCGATAACAG
OsAOS2 RAP-DB: Os03t0225900 GCGAGAGACGGAGAACCC CGACGAGCAACAGCCTTC
OsMAPK6 RAP-DB: Os06g0154500 GATACATTCGCCAACTTCC CAGTGATGCCAGGTAAGG
OsMPAK5a RAP-DB: Os03g17700 GTCTGCTCCGTGATGAAC TGATGCCTATGATGTTCTCG
OsMPAK20 RAP-DB: Os01t0629900 TCAACTCCAATTCCTGCCAAG AACAACTCTTCCTGGTCTTGC
OsNH1 (NPR1) RAP-DB: Os01t0194300 AGAAGTCATTGCCTCCAG ACATCGTCAGAGTCAAGG
OsRAC1 RAP-DB: Os01t0229400 GCTTCTTCCATAATAACAACG AGTTTCTTTCTGGTTACATCC
OsEDS1 RAP-DB: Os09t0392100 CAGGAGAGGCAGTGTTAATCAG GCAAGCGGAGTAAGTGGTATG
OsPAD4 RAP-DB: Os11t0195500 TCAGAGGCAAGGCAGTAGTG ACCGCTCACGCAGGATAG
OsWRKY13 RAP-DB: Os01t0750100 GCCAGCGGAGAACGAATC CTCCTCCTGCTTCACAACC
  1. *http://www6.inra.fr/meloidogyne_incognita.