Skip to main content

Table 2 Primers used to detect INDEL and SSR

From: Molecular relationships between Australian annual wild rice, Oryza meridionalis, and two related perennial forms

Primer name Chr Genome position (nt) Forward primer (5’-3’) Reverse primer (5’-3’) Remarks (O. meridionalisis)
rp116    AGAAATTCTACCTCTTTCTATAAG AATTGCCTCGGTAGGATTTTCC  
ORF100-INDEL    GCCGCTTTAGTCCACTCAGCCATC TCAATGCCTTTTTTCAATGGTCTC 5 bp insert
ctDNA336    ACAGAGGCAAGAAATAACGATTG TTTATTCTTTCTTTCCAATTTTATG For genotyping of ctDNA insertions
mtDNA indel    GACTCTGATTCCCCCACTATGAGAGAGCTG CAGTCCGATGCGTTTGAGCAGTAG’] 4,132 bp deletion
INDEL5 chr10 20772383 AAGTGTGCCTTGCAACCGAG AAGCAGCAGAACACCTGAAAC 20 bp deletion
INDEL7 chr10 21653822 GTAGCTAGTCGACAGGCAGATG TACTGGGTATGTAAACCTGCAC 92 bp deletion
INDEL8 chr5 25412945 GATATATTTGTGCTGGCATTCTC TTCCAGTGAAAATCATATGCAC 33 bp deletion
INDEL9 chr6 28288641 GTGTTCCTAAAACTTATGCATTGTG CTACCAATTAGCTGTATTAACAAG 60 bp deletion
INDEL10 chr3 32263786 ATTTCAACAGCAGAATGGATTTTC GAGCAGTTATAGTAACTTGGAGG 155 bp deletion
SSR1 chr3 10541915 GCCACCGAAACTTGTACCGTC GTAACTTTCTGGTTGTTCCTAAAC SSR
SSR2 chr6 13061135 CTCCACCGTGAATGTACGTAAG CGCATCACCTCCTGCAAC SSR
SSR3 chr10 21872477 CAAAGCTAGCCACTTGCATATG GTCGTCGACGAACTTGGATAG SSR
SSR5 chr4 27568462 CTTGTCAACTACTGTGGCAAG AGAAGATCAACGGTGGTATAG SSR
SSR7 chr10 15561422 CAAGGATGCTATAAGAGCAAAAAC TCCTAACACTCCTATTTCATC SSR
SSR9 chr5 1913 CTGCAAGGATCGCAAACAAAG TATGGAAATTTGTGCGAGGTG SSR
SSR15 chr3 34182494 CCTTGGTATTGGTTTGAATIG TAAAGGATTGCTGGAGAAAGAAG SSR