Skip to main content

Table 1 Gene-specific primers used in real time quantitative RT-PCR analysis

From: Heritable alteration in salt-tolerance in rice induced by introgression from wild rice (Zizania latifolia)

Gene name GenBank Accession No. Forward primer (5′-3′) Reverse primer (5′-3′)
OsNHX1 AB021878 GTTCAAGAGTTACAACAAAGCACG CAGCGGGAATACAAAAGCAG
OsNHX2 AY360145 ACCAAGACGAAACACCCCTAC AACCCAGCAACTACTCCAAGAA
OsHKT1;1 AJ491816 ATTAGCAGAGCACTGTGGAGGAA CCGACGAACCCGTAGGAAG
OsHKT1;3 AJ491818 CAGTTCATCTACCAAAACAATCCA AATACCTCACCACCAATCAGCA
OsHKT1;5 DQ148410 TGCCACCTTACACCACTTTCG TGCCATACGCACTGATAACCTC
OsHKT2;1 AB061311 GCATATTCACCCATTCTGGATTCAGT CGATGGTGATGAGGCTGGAAAGT
OsSOS1 AY785147 CTCCGTGCTCATAGAATCGC ATACTCACTCAAGTGGGTCAATACC
OsCBL4 AK101368 GGCATCGTTCGGATTTCAC GAGATTCGCCTTTCTGCTGTT
OsCIPK24 AK102270 AAGAAGCGGGTGGGGAGGT GCGGTGGTTGAGGATGGTGT
OsAKT1 AY065970 TACGACCGCCGATACAGAA CCAAATAAGCCACAAAGAAGG
OsHAK4 AF129485 CGTTCCCATCCGTCAGTAAA CAGCCTCTGGTCTGGTTCGTC
OsHAK7 AJ427971 GAACTCCAACTTCCTCAAGACG AGATCATGCCGACTTCGACGAG
OsHAK10 AJ427972 CGCTCTCGGCTGCTTTCCT TAACCGCCAATCCTGACGC
OsHAK16 AJ427973 AGCGACTGTGTGCTAAACCC CATAGATGCCAATCCCTGAGA
β-actin AK101613 ATGCCATTCTCCGTCTT GCTCCTGCTCGTAGTC
  1. NHX, Na+/H+ exchanger; HKT, high affinity K+ transporter; HAK, KUP/HAK/KT K+ transporter; AKT, low affinity K+ transporter; SOS, salt overly sensitive.