Skip to main content

Table 2 Primers for Alternative Transcripts Represented in Figs. 3 and 4

From: Analysis of Alternatively Spliced Rice Transcripts Using Microarray Data

Oligo_ID Targeted gene model 5′–3′ (forward) 5′–3′ (reverse)
TR037794 Os02g41860.4 CACCTTCGTGCTCGTCTACA GAAGTGTGCAGCAGTGGTTG
TR037795 Os02g41860.3 GGGGTTCCAGAGCTCGTACT AAGTCAGGGGTACGCACTTG
TR037796 Os02g41860.1 Os02g41860.2 CTGGGATGACCAATGGATCT CGAAGGCTGAATTCGTTGAT
TR031066 Os01g15020.1 GAGAGAAAAGGGCGAGAGGT ACTGGAGGATGAGGAACACG
TR070184 Os01g15020.1 Os01g15020.2 GGAGTGGGATGAAGTGGAGA GCAGATTTGGTATCCCCGTA
TR031065 CB096568 AGCACTTCCCATGCCTTTTT GGGGGTTCGCTTCAATAAGT
TR070173 Os01g14100.1 Os01g14100.2 Os01g14100.3 GGGGATTTTTGGGAGCTTAT TCCGGGAGAAGCATCAATAG
TR030998 Os01g14100.3 CCGGATGAGTCTCCTCTGAC AAATAGGGCGTACGCTTCCT
TR070452 Os01g15020.1 Os01g15020.2 GGGAGTGAACTGTCACAGCA ATAGGTGCCAAAAGCACCAC
TR034207 Os01g15020.2 CACAAGAACATTGCGCTCTT TGATGAGCTTCGTCTTGGTG