Open Access

Fine Mapping of HWC2, a Complementary Hybrid Weakness Gene, and Haplotype Analysis Around the Locus in Rice

  • Tsutomu Kuboyama1,
  • Toshiya Saito1,
  • Takashi Matsumoto3,
  • Jianzhong Wu3,
  • Hiroyuki Kanamori4,
  • Satoru Taura5,
  • Muneharu Sato2,
  • Wataru Marubashi6 and
  • Katsuyuki Ichitani2Email author
Rice20092:9026

DOI: 10.1007/s12284-009-9026-y

Received: 25 March 2009

Accepted: 13 May 2009

Published: 10 June 2009

Abstract

Hybrid weakness is a reproductive barrier. In rice, the hybrid weakness caused by two complementary genes––HWC1 and HWC2––has been surveyed extensively. However, their gene products and the molecular mechanism that causes hybrid weakness have remained unknown. We first performed fine mapping of HWC2, narrowing down the area of interest to 19 kb. We thereby identified five candidate genes. Second, we performed haplotype analysis around the HWC2 locus of 33 cultivars. With 15 DNA markers examined, all the 13 Hwc2-1 carriers share the same haplotype for consecutive 14 DNA markers. As for hwc2-2 carriers, five out of 20 have the haplotypes relatively similar to those of Hwc2-1 carriers. However, the other haplotypes differ remarkably from them. These results are useful to identify the HWC2 gene and to study rice varietal differentiation.

Keywords

Reproductive barrier Linkage analysis Haplotype analysis Hybrid weakness

Introduction

Hybrid weakness is a reproductive barrier. It can be defined as weak growth occurring in hybrids derived from crosses between two normal strains. According to its degree or symptom, it is also called hybrid lethality, hybrid abnormality, or hybrid necrosis. This phenomenon has been observed in many plant species including Arabidopsis thaliana (Bomblies et al. 2007) and Phaseolus vulgaris (Shii et al. 1980).

In Asian cultivated rice (Oryza sativa), two hybrid weakness phenomena from different cross combinations have been reported (for a review, see Sato 1997). One reportedly exists in some Indian rice crosses (Oka 1957), the other in the cross between a Peruvian cultivar Jamaica and Japanese lowland cultivars such as Norin 8 (Amemiya and Akemine 1963). Among the two hybrid weakness phenomena, the latter phenomenon has been studied more extensively. Genetically, this hybrid weakness is caused by two complementary genes: Hwc1from Jamaica and Hwc2 from Japanese lowland cultivars. According to the new gene nomenclature system for rice (McCouch 2008), we hereafter change our description of the gene symbols, as shown in Table 1. The distribution of the two genes was surveyed by Sato and Hayashi (1983) and Sato and Morishima (1987). Among the cultivars they surveyed, most of temperate Japonica cultivars carry Hwc2-1, although few tropical Japonica and Indica cultivars carry this gene. None of the 30 strains of wild relatives (Oryza rufipogon and Oryza nivara) carries Hwc2-1. As for HWC1, Jamaica is reportedly the only carrier of Hwc1-1 gene. From these results, Sato and Morishima (1988) inferred that the Hwc2-1 gene arose at an early stage of differentiation of temperate Japonica cultivars.
Table 1

Gene Symbols Frequently Used in This Study According to the New Gene Nomenclature System for Rice (McCouch 2008)

 

Old

New

Gene full name

Gene symbol

Gene full name

Gene symbol

Locus/gene

Hybrid weakness c1

Hwc1

Hybrid WEAKNESS C1

HWC1

Dominant allele

Hybrid weakness c1

Hwc1

Hybrid weakness c1-1

Hwc1-1

Recessive allele

hybrid weakness c1

hwc1

hybrid weakness c1-2

hwc1-2

Locus/gene

Hybrid weakness c2

Hwc2

Hybrid WEAKNESS C2

HWC2

Dominant allele

Hybrid weakness c2

Hwc2

Hybrid weakness c2-1

Hwc2-1

Recessive allele

hybrid weakness c2

hwc2

hybrid weakness c2-2

hwc2-2

The molecular mechanism of the hybrid weakness has remained unknown. To understand the mechanism, we should clarify the causal genes and their gene products. We selected a map-based cloning strategy to identify the two causal genes: HWC1 and HWC2. We performed linkage analysis of HWC1 (Ichitani et al. 2007) and thereby located this locus on the long arm of chromosome 1, narrowing down the area of interest to 60 kb. We also performed linkage analysis of HWC2 (Ichitani et al. 2001) and tagged this locus between the two restriction fragment length polymorphism (RFLP) markers on the long arm of chromosome 4. However, we have not located this gene on a physical map. In the present study, we performed high-resolution mapping of HWC2, narrowing down the area of interest to 19 kb. We also performed haplotype analysis around the HWC2 locus and identified linkage disequilibrium around this locus.

Results

Fine mapping using the F2 population from the cross between Nipponbare and Kasalath

First, we selected the F2 population from the cross between the two cultivars, Nipponbare and Kasalath, as a mapping population (Table 2) for two reasons: first, our preliminary experiments indicated that Nipponbare carries Hwc2-1, whereas Kasalath carries neither Hwc1-1 nor Hwc2-1. The second reason is that high-density rice linkage maps have already been constructed using the same cross combination (Kurata et al. 1994; Harushima et al. 1998). This DNA marker information is also useful for HWC2 mapping. Our previous study (Ichitani et al. 2001) showed that HWC2 is encompassed by the two RFLP markers, XNpb264 and XNpb197. In the present study, a sequence-tagged site (STS) marker C11112 and a cleaved amplified polymorphic sequence (CAPS) marker C1016 (Table 3, Fig. 1a, b) were used for selecting recombinants around the HWC2 locus in 2003 because the two markers encompass the two RFLP markers and show polymorphism between the two cultivars. In all, 209 recombinants between the two DNA markers were selected from 1,190 F2 plants. Among them, 165 recombinants were crossed to Jamaica to determine each genotype for the HWC2 locus. This means that the number of F2 plants in 2003 was equivalent to 939 (=1,190 × 165/209). Then, these recombinants were analyzed for the genotypes of the DNA markers encompassed by C11112 and C1016 to localize the HWC2 locus. Results of this analysis showed that the HWC2 locus was located between 93*14.1 and RM5473 and that the target region could be narrowed down to 298 kb.
Table 2

The Cross Combinations for HWC2 Fine Mapping

Cross combination

Parent carrying Hwc2-1

Parent carrying hwc2-2

Year

No. of plants

DNA marker pairs for recombinant seedlings

Marker distance (kb)

No. of recombinants

Nipponbare

Kasalath

2003

1,190

C11112/C1016

3,027

209

Nipponbare

Kasalath

2004

2,100

93*14.1/S13714

314

37

Nipponbare

Kasalath

2004

890a

93*14.1/S13714

314

9

Akage

Asominori

2005

159

d54950/RM3843

240

0

Kinmaze

Asominori

2005

149

174*4D/RM3843

252

1

Nipponbare

Katakutara

2005

173

C174*12/RM3843

174

2

Akihikari

Katakutara

2005

317

d54950/RM3843

240

7

Nekken 2

Kasalath

2005

233

174*4D/S13714

260

13

Nekken 2

Silewah

2005

70

174*4D/RM3843

252

4

Nekken 2

Kasalath

2006

634

RM3687/S13714

209

5

Kinmaze

IR24

2006

370

174*4D/RM5473

245

13

Kinmaze

Asominori

2006

58

174*4D/RM5473

245

0

Akihikari

Katakutara

2006

1,475

174*4D/RM5473

245

29

Koshihikari

Te-Tep

2006

931

RM5503/RM3836

1,448

146

Akihikari

Nanjing 11

2006

399

RM3687/S13714

209

5

J-147

Asominori

2006

284

174*4D/RM5473

245

1

Akage

Asominori

2006

262

d54950/RM5473

245

0

Taichung 65

Ashkata

2006

364

RM5503/RM3836

1,448

54

Akihikari

Bhutmuri

2006

208

RM3687/RM5473

193

4

Akihikari

Kele

2006

313

RM3687/RM5473

193

2

Hayakogane

Nanjing 11

2006

459

RM3687/S13714

209

4

Taichung 65

Milyang 23

2006

237

RM5503/RM3836

1,448

29

aThree-way cross combination (Nipponbare × Kasalath) × Jamaica. The other cross combinations were F2 generation

Table 3

Primer Sequences Designed and Used for Fine Mapping of the HWC2 Locus

Marker

Kind of DNA marker (restriction enzyme)

Primer sequence(5′–3′)

Position in Nipponbare chromosome 4 (AP008210)

Source

From

To

C11112

STS

F

CCAGCAACAGGGGATGAAGC

30325704

30325548

RGPa

R

CAGGCATAAAACGGAGTGGC

RM5503

SSR

F

GGGAAGAAGATAGGAGATGG

30397622

30397822

McCouch et al. 2002

R

CTCTGGGTACACTTCACGAG

RM1250

SSR

F

GAAACCACGACTAGGCATCG

31296033

31296199

McCouch et al. 2002

R

CTTCCACAAGGTCTCGCTTC

0093No3

CAPS (RsaI)

F

TGTCCCATATCCTCCTTCAC

31335526

31335717

This study

R

ACATGGCACACTAGGCTCAC

93*14.1

dCAPS (HindIII)

F

CTTTGTCTCTCTTTTTCTTCCACTAAG

31412533

31412724

This study

R

AGTGCAAAAGTATTTCCGTG

174*4D

STS

F

CCGCATGCGCCAAGAAATCC

31465900

31466061

This study

R

TCACGGCGCCACCACACGAC

d54950

STS

F

CCATCATGCTGAACAAGCTCATTGGAT

31477258

31477426

This study

R

TACTCCATCGTGTCCGTGTC

RM3687

SSR

F

CTCCTGAGAAGTGGGGACTG

31517541

31517704

McCouch et al. 2002

R

AGTCCTCCATGCATGTGACC

KGC4M1

STS

F

CCGATCAGGTGACCAAACTT

31533990

31534079

This study

R

GATGCATTGACCATGGAAGA

KGC4M2

STS

F

AACGGATCTGGATAGGACCA

31536677

31536812

This study

R

GGAGTTGTCTTCTTCCACTGC

C174*12

CAPS (RsaI)

F

CCTTTGCTGGTGTCAAGTCA

31543923

31544160

This study

R

ACTGGTGCTTCCTGGTCCTA

KGC4M3

STS

F

TGTTGAAATAAGACGGCTTGG

31559019

31559107

This study

R

CGTTAGCTTCGCTTTCAGTG

dG264H

dCAPS (HindIII)

F

ACCAGGAGATGACAACACAG

31560681

31560890

This study

R

ATCCGCTCCAAATCAGCAAAGCT

C174*15

CAPS (MboII)

F

CAGTGGGCTTGTGGGTAAGT

31572635

31572793

This study

R

GCACAGCACAGTCAAAGTGG

111*1

dCAPS (HindIII)

F

AGAGATGTTAGCAATTTCAATG

31588152

331588361

This study

R

CTGTTCCTATCATTTGTGCAACCAAG

KGC4M5

STS

F

AATCCCATCGCCCTTGTT

31611674

31611742

This study

R

CTGCTGCTGCGGAGACAC

C111*4

CAPS (MboII)

F

TTGGGAGGAAAATAGCTAAGGA

31627739

31627938

This study

R

TTGCTGTAAGTGGCTGGGTA

KGC4M10

STS

F

AATTGATTACTGGATGGCTTGATAA

31630713

31631087

This study

R

GGAAGTAGACGAAATCGATGGTAT

KGC4M20

STS

F

ACGAGGCGATGTGTCATGT

31644658

31644749

This study

R

GCCAGTCCAAACGAACACTTAT

C111*8

CAPS (MboII)

F

GTCAGCAGACAACCAGGTGA

31668298

31668529

This study

R

CAGCATTATGGTTGAGCATG

KGC4M21

STS

F

CGGAAGGTCAAAATTAATCAGAG

31678330

31696684

This study

R

ACAGCAATCATCCTTTTCAGTAGAT

KGC4M8

STS

F

TGCCTTTTGCTTACCACTGA

31690516

31690609

This study

R

AGATCCGGCGGAAGAGAA

KGC4M28

CAPS (HindIII)

F

GTATGCAAGATGTATCCATTTTTGTGTC

31690926

31691142

This study

R

CATTTTCTTCTTCAGTGATATCAAAGTGC

KGC4M29

CAPS (RsaI)

F

CAATCACTTGAGGAACTTTACATCCA

31695274

31695409

This study

R

AAGAATGGAGCTGCAGAGACACTAAAT

KGC4M23

CAPS (HpaI)

F

GTGGTTGGGATCGGAATTG

31699144

31699571

This study

R

TCACTACCGTTATATGTTCACGAAT

KGC4M30

dCAPS (PstI)

F

CAATATAAATGTTGTTTTGTAAGCATTCTA

31701502

31701604

This study

R

TCTTTACTAAATATATCGTTTTTCTTCTGC

IBA44

STS

F

CTGGACGATATCCACGAACC

31704500

31704669

This study

R

TGGGACCAGGTAGGACTTTG

KGC4M31

dCAPS (HpaI)

F

GCCCTTAGTGTCATAGAGAGCATAA

31705085

31705215

This study

R

TGTTTGATCATGACCTTGAGAGTT

KGC4M27

STS

F

TGTGTGATACAATAACACCCAATG

31709144

31709269

This study

R

ACCTAGTTAAATTCCAACGTCCAA

RM5473

SSR

F

ACACGGAGATAAGACACGAG

31710458

31710562

McCouch et al. 2002

R

CGAGATTAACGTCGTCCTC

KGC4M18

STS

F

TGCTTGTGAAAAAGAGGGAAT

31716481

31716558

This study

R

GCTGTGAACAGACCATAGTATTGAA

RM3843

SSR

F

ACCCTACTCCCAACAGTCCC

31717543

31717696

McCouch et al. 2002

R

GGGGTCGTACGCTCATGTC

S13174

STS

F

CGGTTGCAGTGATCGAATTG

31726177

31726399

RGP

R

CCAAATTCCCTGCCAACGAC

KGC4M52

STS

F

GTTGTTGCGTATTCTTTGGATTC

31810027

31810150

This study

R

CGCAATAATAATACAGGATAAACATAAAA

RM3836

SSR

F

ACTGTGGAGTACAGGTCGGC

31845478

31845603

McCouch et al. 2002

R

GAAACGGAAACGAAACCCTC

C1016

CAPS (HaeIII)

F

CACGCTCTTTCTATGTTTCC

33352175

33352823

RGP, modified in this study

R

ATTACAACCACCCCTCCTC

Fig. 1

Location of HWC2 on rice chromosome 4. a Approximate location of the C1112 and C1016, initially used DNA markers for recombinants around the HWC2 locus from the cross between Nipponbare and Kasalath, on the high-density linkage map of chromosome 4 modified from Harushima et al. (1998). b Fine mapping of HWC2 using the cross between Nipponbare and Kasalath. A total of 50 recombinants between two DNA markers, 93*14.1 and S13714, were crossed to Jamaica and were analyzed for the order of HWC2 and the internal DNA markers. c The 19-kb region containing HWC2, narrowed down by using all the cross combinations in Table 2, on the rice BAC clone OSJNBa0053K19 and positions of ORFs predicted using RiceGAAS (Sakata et al. 2002).

In 2004, 37 recombinants between two DNA markers, 93*14.1 and S13714, were selected from 2,100 F2 plants from the same cross combination. Among them, 33 recombinants were crossed to Jamaica to determine each genotype for the HWC2 locus. This means that the number of F2 plants in 2004 was equivalent to 1,873 (=2,100 × 33/37). Nine recombinants were found in the three-way cross population consisting of 890 plants. Consequently, the HWC2 locus was located between dG264H and RM5473; the target region was narrowed down to 150 kb. As for the HWC1 locus, the area of interest was narrowed to 60 kb using 883 F2 plants (Ichitani et al. 2007). Therefore, we inferred that crossover events were suppressed around the HWC2 locus in this cross combination. In Fig. 1b, recombination events per kilobase pair of 50 recombinants between 93*14.1 and S13714 were calculated for each pair of neighboring DNA markers. We observed the tendency that recombination events per kilobase pair were smaller for the DNA marker pairs that were closer to the HWC2 locus, supporting the inference presented above.

Fine mapping using the F2 population from other cross combinations

We examined 1,101 F2 plants from other six cross combinations in 2005 to avoid the recombination suppression problem (Table 2). One useful recombinant was obtained from the cross between Kinmaze and Asominori. The recombination event occurred between C111*4 and C111*8, localizing the HWC2 locus between C111*4 and RM5473. In 2006, we examined 5,994 F2 plants from 13 cross combinations (Table 2). We confirmed the result in 2005 and obtained one useful recombinant from the cross between Kinmaze and IR24. The recombination event occurred between KGC4M28 and KGC4M29, localizing the HWC2 locus between KGC4M28 and RM5473. From 2003 to 2006, RM5473 has remained the nearest DNA markers from the telomere of the long arm. These results showed that the position of HWC2 was confined to about the 19-kb region between the two DNA markers, KGC4M28 and RM5473, both of which were located on the Nipponbare bacterial artificial chromosome (BAC) clone OSJNBa0053K19 (Table 2, Fig. 1c)

Candidate gene analysis

In all, five open reading frames (ORFs) were found between KGC4M28 and RM5473 in Nipponbare genome (Feng et al. 2002; Fig. 1c, Table 4). In an Indica cultivar Guangluai 4 genome, of which 2.3 Mb of three contiguous segments of chromosome 4 was sequenced (Feng et al. 2002), corresponding ORFs were found in the same order (data not shown). According to the Rice Full-Length cDNA Consortium (2003), all ORFs but ORF4 are expressed.
Table 4

Candidate Genes in the HWC2 Region with the aid of RiceGAAS (Sakata et al. 2002)

ORF

Protein

Rice ESTs

EST source

Corresponding predicted genes in

RAP-DBa

MSU rice genome annotationb

1

Putative XA1

AK105096c

Nipponbare

Os04g0622600

LOC_Os04g53160

AB002266d

IRBB1

2

putative RING3

AK067276c

Nipponbare

Os04g0623100

LOC_Os04g53170

3

Unknown protein

AK105231c

Nipponbare

Os04g0623200

LOC_Os04g53180

4

Hypothetical protein

  

None

None

5

Putative LSD1

AK064902c

Nipponbare

Os04g0623300

LOC_Os04g53190

aThe Rice Annotation Project (2008)

bOuyang et al. (2007)

cThe Rice Full-Length cDNA Consortium (2003)

dYoshimura et al. (1998)

In fact, ORF1 has some similarity with a blight resistance gene Xa1 (Yoshimura et al. 1998) from IRBB1, a near-isogenic line for bacterial blight genes (Ogawa et al. 1991), and has NBS-LRR motif, which is detected in most plant pest resistance genes. A reported full-length cDNA AK105096 covers only 20% of ORF1; its sequence coincides completely with the 3′ region of ORF1. The number of amino acids in ORF1 is similar to that in XA1. Therefore, longer full-length cDNA corresponding to ORF1 might exist in Nipponbare genome. In addition, ORF2 exhibits similarity with the human RING3 gene (Thorpe et al. 1996); ORF2 and RING3 share bromodomain. Although ORF3 has no similarity with known genes, this gene is expressed. ORF4 has only 12 residues and has no similarity with a known protein. Also, ORF5 encodes a protein similar to LSD1, which represses transcription by demethylating histone H3 at K4, whose methylation is linked to active transcription (Shi et al. 2004).

Haplotype analysis

Banding patterns of 15 DNA markers around HWC2 locus of 33 cultivars were arranged in Fig. 2. The result of χ 2 test for independence indicated that significant deviation from the expected ratio (P < 0.01) was observed between the genotype for the HWC2 locus and the banding patterns of all DNA markers except KGC4M1 (P = 0.55), IBA44 (P = 0.41), and S13714 (P = 0.09). As for IBA44 and S13714, the banding patterns not represented by Nipponbare were very few, leading to nonsignificant results. The two markers were designed based on the insertion/deletion between Nipponbare and Kasalath. As a whole, linkage disequilibrium was observed around the HWC2 locus, supporting the result of the fine mapping (Fig. 1c). The banding patterns of KGC4M29 and KGC4M31 coincided with the genotypes for the HWC2 locus. All cultivars produced a single band when using the KGC4M31 primer pair. The polymerase chain reaction (PCR) products were digested with the restriction enzyme HpaI in all the hwc2-2 carriers, although they were not digested with the enzyme in any Hwc2-1 carriers. As for KGC4M29, one PCR product was produced and was not digested with RsaI in Hwc2-1 carriers. In contrast, the PCR products were all digested in hwc2-2 carriers except for a few cultivars: before the digestion with RsaI, Te-Tep showed one band with the same migration distance as the other cultivars. After the digestion, the band proved to be composed of two PCR products: one was digested with RsaI, the other not. The four cultivars, Nanjing 11, Guangluai 4, Culture 340, and Silewah, produced no bands with the KGC4M29 primer pair.
Fig. 2

Haplotype diversity around the HWC2 locus. Banding patterns of 15 DNA markers around HWC2 locus from KGC4M1 to KGC4M52 were analyzed for 33 cultivars whose genotypes of the HWC2 locus had been identified, including parental cultivars of the fine mapping of the HWC2 gene (Table 2). When the countries from which cultivars are originated are not specified, they are from Japan. The same banding patterns as Nipponbare are indicated by solid rectangles; the other patterns are indicated by shaded and dotted rectangles. Open rectangles indicate that no bands appeared. To the left is the genetic relationship among the 13 haplotypes by UPGMA cluster analysis. Each fragment size of the 15 DNA markers was treated as a unique characteristic and scored as present (1) or absent (0). The data matrix was used to calculate genetic similarities using the Jaccard (1908) coefficient.

For all the DNA markers except KGC4M1, the banding pattern carried by Nipponbare was mostly shared by Hwc2-1 carriers. Among them, Koshihikari, Akihikari, and Taichung 65 are generally classified as temperate Japonica. The Hwc2-1 carriers share the same haplotype ranging from KGC4M5 to KGC4M52. On the other hand, the other banding patterns and null bands were not shared by Hwc2-1 carriers but by hwc2-2 carriers. Among them, IR24, Milyang 23, Guangluai 4, and Kasalath are generally classified as Indica whereas Jamaica and Silewah are generally classified as tropical Japonica, and Norin 11, Iburiwase, and Asominori are generally classified as temperate Japonica. With 15 DNA markers scattered on the 276 kb of Nipponbare genome covering HWC2 gene, the cultivars examined were classified into 13 haplotypes. The relationship between haplotypes is portrayed in Fig. 2. The cultivars were largely divided into two groups: one composed of Hwc2-1 carriers and hwc2-2 carriers whose haplotypes were relatively similar to those of Hwc2-1 carriers and the other composed of hwc2-2 carriers whose haplotypes differ remarkably from those of Hwc2-1 carriers.

Discussion

Our previous study showed that the HWC2 locus was located within the 3.9-cM region between two RFLP markers: XNpb264 and XNpb197. The present study localized this gene on 19-kb region of the chromosome 4 physical map, where five candidate genes were annotated. We first selected the F2 population from the cross between Nipponbare and Kasalath because of high DNA polymorphism and accumulation of DNA marker information. However, the candidate region was not narrowed down to less than 150 kb even though approximately 6,500 gametes were analyzed. We further examined 14,190 gametes from 18 kinds of other cross combinations and finally narrowed down the area of interest to 19 kb. In the cross between Nipponbare and Kasalath, chromosomal rearrangement such as inversion and insertion near the HWC2 locus probably suppressed crossover events thereby.

Bomblies et al. (2007) showed that hybrid necrosis in A. thaliana was caused by complementary effect of two genes and that one causal gene encodes NB-LRR protein. This fact suggests that ORF1 can be a good candidate of HWC2. ORF2 was annotated to contain bromodomain, which is widely distributed among the different enzymes that acetylate, methylate, or remodel chromatin; it also has the ability to bind acetylated histone tails in vivo (De la Cruz et al. 2005). Therefore, it has been thought that chromatin-remodeling enzymes can utilize the bromodomain to find and/or act on their targets. Shi et al. (2004) showed that LSD1 specifically demethylates histone H3 lysine 4, which is linked to active transcription. ORF5, a homolog of LSD1, might catalyze the same reaction. Unusual expression of ORF2 or ORF5, working together with HWC1, might affect expression of other genes, engendering hybrid weakness.

Result of the haplotype analysis was consistent with the result of fine mapping. Among the DNA markers examined, the genotypes of KGC4M29 and KGC4M31 completely coincided with those for HWC2. The recognition site in KGC4M29 was located in ORF1, whereas that of KGC4M31 was in ORF5 (Fig. 1c). The results of the haplotype analysis suggest that ORF1 and ORF5 are the good candidates of HWC2 gene, as inferred from their predicted functions.

The haplotype analysis also offered interesting results from the perspective of rice varietal differentiation. The Hwc2-1 carriers share the same haplotype ranging from KGC4M5 to KGC4M52. The hwc2-2 carriers have different haplotypes, most of which are distinct from those of the Hwc2-1 carriers. Many haplotypes in hwc2-2 carriers and only two haplotypes in Hwc2-2 carriers led us to the following inferences: (1) the hwc2-2 alleles have been differentiated at sequence level, some similar to Hwc2-1, others not. (2) The “gain-of-function” mutation from hwc2-2, probably of haplotype 3, to Hwc2-1 occurred. (3) Hwc2-1 gene diffused in temperate Japonica, dragging adjacent genes with it. To identify the origin and diffusion process of Hwc2-1 and adjacent genes, we are undertaking larger haplotype analysis around HWC2. The DNA markers developed in this study will be very useful for that purpose. After cloning of HWC2, we also plan to perform the sequence analysis of HWC2 to clarify the relation between the haplotypes and HWC2 alleles or sequence variants.

Results of our previous study (Ichitani et al. 2001) indicated that HWC2 and Xa1 loci are closely linked to each other. A Japanese cultivar, Kogyoku, shows an example of conserved linkage block covering hwc2-2 and Xa1 surviving the selection in rice breeding history in Japan, where Hwc2-1 carrier temperate Japonica cultivars have been prevalent (Sato and Hayashi 1983). Amemiya and Akemine (1963) reported that Kogyoku, which was originally written in Chinese characters and was called Kidama in Amemiya and Akemine (1963), does not carry Hwc2-1. Kogyoku carries a bacterial blight gene Xa1, which was introduced into a susceptible cultivar IR24 background by backcrossing to develop an isogenic line IRBB1 (Ogawa et al. 1991). The cDNA sequence of Xa1 (AB002266; Yoshimura et al. 1998) of IRBB1 differed greatly from the corresponding sequence of Nipponbare, a typical temperate Japonica cultivar in Japan. The haplotype of the 15 DNA markers of Kogyoku is also very different from that of Nipponbare (Fig. 2). Nevertheless, we compared the electrophoresis patterns of the two cultivars of the 36 STS markers scattering on all the chromosomes with the result that the two cultivars share the same patterns except for one marker on chromosome 10 (Ichitani et al., unpublished results). These facts imply that the chromosomal segment encompassing hwc2-2 and Xa1 gene pair of Kogyoku originated from Indica or tropical Japonica was introduced to temperate Japonica background by introgression. A similar story might be applied to hwc2-2 carrier Japanese cultivars Norin 11, Iburiwase, and Asominori, and the opposite case might be an Hwc2-1 carrier Malaysian cultivar Ketan Nangka, which is generally classified into tropical Japonica (Fig. 2).

Recently, two blast resistance gene have been mapped proximal to the HWC2 locus: (1) a strong quantitative trait locus of field rice blast resistance named Pikahei-1(t) from upland rice cultivars Kahei cosegregated with RM5473 and mapped within 300 kb (Xu et al. 2008). (2) A blast field resistance gene Pi39(t) from Chubu 111 cosegregated with RM5473 and RM3843 (Terashima et al. 2008). A blight resistance gene Xa2 (He et al. 2006) from a Vietnamese cultivar Te-Tep and a gall midge resistance gene Gm7 (Sardesai et al. 2002) from an Indica cultivar RP2333 are also located proximal to the HWC2 locus. These resistance genes might have been introgressed into the local cultivars grown in the region where the above pests have been prevalent and have contributed to the adaptability of these cultivars. The alleles of the HWC2 locus must have been dragged along by these resistance genes. Discussion of the distribution of HWC2 gene should include the effect of linked genes on regional adaptability. The haplotype analysis showed that the banding pattern of KGC4M1 was independent of the genotype for the HWC2 locus, although they are linked closely to each other genetically. This independence suggests that a small patch of chromosomal region around the HWC2 locus might have been under selective pressure. Sato and Morishima (1987) reported a latitudinal cline of HWC2 gene: Hwc2-1 is more frequent in the more northern regions. The conserved haplotype around HWC2 locus that is observed in Hwc2-1 carriers might reflect the existence of linkage block adjusting to the environment of high latitudes.

We are performing closer linkage analyses of both HWC1 and HWC2 genes to clone them. Identification of these genes will contribute to understanding of the molecular mechanism causing hybrid weakness and rice varietal differentiation.

Materials and methods

Mapping strategy

The F2 or three-way cross populations in which the HWC2 gene segregated (Table 2) were grown in nurseries. At the seedling stage, recombinants between two DNA markers encompassing the HWC2 locus were selected and transplanted individually in plastic pots. The detection of the genotypes of the recombinants for the HWC2 locus followed the procedure described by Ichitani et al. (2001). They were crossed with Hwc1-1 carrier Jamaica as a pollen donor. After harvest, hybrid seeds were dried at 50°C for 5 days to break dormancy. They were sown on Petri dishes containing 5-mm-deep tap water and left in the dark at 28°C for 5 days. The genotypes of each recombinant were estimated to be Hwc2-1/Hwc2-1 if all hybrid plants showed inhibition of root elongation (usually less than 1 cm), hwc2-2/hwc2-2 if they showed normal root elongation (usually more than 5 cm), and Hwc2-1/hwc2-2 if hybrid plants segregated. A few intermediate phenotypes were transplanted in pots and grown for 1 month to check if hybrid weakness symptom as reported in our previous paper (Saito et al. 2007) was observed or not. The genotypes of internal DNA markers between the two initial encompassing markers of HWC2 (Table 3) were tested to narrow down the area of interest.

DNA marker analysis

The DNA was extracted according to Dellaporta et al. (1983) with some modifications. The PCR conditions for STS, simple sequence repeat (SSR), and CAPS markers used in this study (Table 3) were: 95°C for 10 min, 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, followed by a final extension of 72°C for 1 min, except that the annealing temperature of KGC4M29 was 60°C instead of 55°C. Those for derived CAPS (dCAPS) markers were: 95°C for 10 min, ten cycles of 94°C for 30 s, 55°C for 2 min, and 72°C for 30 s, followed by 25 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, with a final extension of 72°C for 1 min, except that the annealing temperature of KGC4M30 was 50°C instead of 55°C. The PCR mixture (5 μl) contained 10-ng template DNA, 200 mM of each dNTP, 0.2 μM of primers, 0.25 units of Taq polymerase (AmpliTaq Gold; Applied BioSystems), and 1× buffers containing MgCl2. As for KGC4M23, which contains GC-rich sequences, we used Takara LA Taq with GC buffer I (Takara Bio Inc.) instead of AmpliTaq. The PCR condition for KGC4M23 was 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 1 min. The PCR products were analyzed using electrophoresis in 10% (29:1) polyacrylamide gel or 3% agarose gel, followed by ethidium bromide staining and viewing under ultraviolet light irradiation. The PCR products of CAPS and dCAPS markers were digested by respective restriction enzymes (Table 3) before electrophoresis.

Development of new DNA markers

Because the target region has been narrowed, no published DNA markers were present there. Therefore, we developed new PCR-based DNA markers. We collected DNA sequences covering the target region of three cultivars, Nipponbare, 93-11, and Guangluai 4. The Nipponbare chromosome 4 was sequenced completely (Feng et al. 2002). 93-11 is a parental cultivar of a superhybrid rice grown in China. It belongs to Indica: its draft sequence was produced by whole-genome shotgun sequencing (Yu et al. 2002). Guangluai 4 belongs to Indica. Its 2.3 Mb of three contiguous segments of chromosome 4 was sequenced (Feng et al. 2002). We also selected a Kasalath BAC clone K0211H09 covering the HWC2 region by BLAST searching for BAC end sequences (http://rgp.dna.affrc.go.jp/blast/runblast.html, Katagiri et al. 2004). Shotgun sequencing was performed for the clone. We have already constructed a BAC library of Jamaica, which consists of 19,282 clones with average insert size of 104 kb, to clone HWC1 gene from Jamaica. From the BAC library, we selected three Jamaica BAC clones covering the HWC2 region by PCR screening using the most tightly linked DNA markers of HWC2 at that point using three-dimensional BAC pools as template DNA. Shotgun sequencing was performed also for these clones. The sequences of Kasalath and Jamaica consisted of several contigs and were therefore incomplete, but they provided sufficient information for the development of new DNA markers. The complete sequences of the two cultivars covering the HWC2 region will be published elsewhere in the near future. We made alignments of the sequences of the five cultivars using DNAsis Pro (Hitachi Software Engineering Co. Ltd.) and detected substitutions and insertion/deletion (indels). We tried to produce STS markers by designing primers encompassing indels using Primer 3 (Rozen and Skaletsky 2000) if the indel size was longer than three bases. Regarding substitutions and indels shorter than four bases, we searched for restriction enzyme recognition sites along the polymorphic sequences with DNAsis Pro. We tried to produce CAPS markers by designing primers encompassing restriction enzyme recognition sites using Primer 3 if restriction enzyme recognition sites were present. Otherwise, we tried to make dCAPS markers by designing dCAPS primers including necessary mismatches using dCAPS finder 2.0 (Neff et al. 2002) and reverse primers using Primer 3.

Gene annotation

ORFs in the Nipponbare genomic DNA sequences containing the HWC2 gene and the corresponding Guangluai 4 genomic sequences were predicted using a rice genome automated annotation system (RiceGAAS; Sakata et al. 2002 or http://RiceGAAS.dna.affrc.go.jp).

Haplotype analysis

We examined the genotypes of 15 DNA markers in the target region (Fig. 2) of 33 cultivars whose genotypes of the HWC2 locus had been identified, including parental cultivars of the fine mapping of HWC2 gene (Table 2). Actually, J-25, J-105, J-147, and J-177 were provided by Dr. Y. I. Sato, Research Institute for Humanity and Nature, Japan. The National BioResource Project, Japan, provided J-196 and J-211. Kogyoku and Guangluai 4 were provided by the Genebank of the National Institute of Agrobiological Sciences, Japan.

Cluster analysis of haplotypes

Genetic relations among the 13 haplotypes of HWC2 region (Fig. 2) were evaluated using the 15 DNA markers. Each fragment size was treated as a unique characteristic and scored as present (1) or absent (0). The data matrix was used to calculate genetic similarities using the Jaccard (1908) coefficient. A phenogram of 13 haplotypes was constructed using unweighted pair-group method with an arithmetic mean (UPGMA) using software (NTSYS-pc ver. 2.2; Exeter Software).

Notes

Declarations

Acknowledgements

We gratefully acknowledge Dr. Atsushi Yoshimura of Kyushu University for valuable technical advice on DNA markers. We are also grateful to Dr. Yo-Ichiro Sato of the Research Institute for Humanity and Nature, National BioResource Project, and the Genebank of the National Institute of Agrobiological Sciences for their kind provision of rice cultivars. We thank Mr. Takashi Sakamoto of Kagoshima University and Ms. Mariko Ono of University of Otago for their technical assistance. This work was funded by the Ministry of Education, Culture, Sports, Science, and Technology and by the Ministry of Agriculture, Forestry, and Fisheries of Japan (Green Technology Project GD-2005), Japan.

Authors’ Affiliations

(1)
College of Agriculture, Ibaraki University
(2)
Faculty of Agriculture, Kagoshima University
(3)
National Institute of Agrobiological Resources
(4)
Institute of the Society for Techno-Innovation of Agriculture, Forestry, and Fisheries
(5)
Institute of Gene Research, Kagoshima University
(6)
School of Agriculture, Meiji University

References

  1. Amemiya A, Akemine H. Biochemical genetic studies on the root growth inhibiting complementary lethals in rice plant (studies on the embryo culture in rice plant. 3). Bull Nat Inst Agric Sci. 1963;D10:139–226. in Japanese with English summary.Google Scholar
  2. Bomblies K, Lempe J, Epple P, Warthmann N, Lanz C, Dangl JL, et al. Autoimmune response as a mechanism for a Dobzhansky–Muller-type incompatibility syndrome in plants. PLoS Biol. 2007;9:1962–72.Google Scholar
  3. De la Cruz X, Lois S, Sanchez-Molina S, Martinez-Balbas MA. Do protein motifs read the histone code? BioEssays. 2005;27:164–75.PubMedView ArticleGoogle Scholar
  4. Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: version II. Plant Mol Biol Rep. 1983;1:19–21.View ArticleGoogle Scholar
  5. Feng Q, et al. Sequence and analysis of rice chromosome 4. Nature. 2002;420:316–20.PubMedView ArticleGoogle Scholar
  6. Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, et al. A high-density rice genetic linkage map with 2, 275 markers using a single F2 population. Genetics. 1998;148:479–94.PubMedPubMed CentralGoogle Scholar
  7. He Q, Li D, Zhu Y, Tan M, Zhang D, Lin X. Fine mapping of Xa2, a bacterial blight resistance gene in rice. Mol Breed. 2006;17:1–6.View ArticleGoogle Scholar
  8. Ichitani K, Fukuta Y, Taura S, Sato M. Chromosomal location of Hwc2, one of the complementary hybrid weakness genes, in rice. Plant Breed. 2001;120:523–5.View ArticleGoogle Scholar
  9. Ichitani K, Namigoshi K, Sato M, Taura S, Aoki M, Matsumoto Y, et al. Fine mapping and allelic dosage effect of Hwc1, a complementary hybrid weakness gene in rice. Theor Appl Genet. 2007;114:1407–15.PubMedView ArticleGoogle Scholar
  10. Jaccard P. Nouvelles recherches sur la distribution florale. Bull Soc Vaudoise Sci Nat. 1908;44:223–70.Google Scholar
  11. Katagiri S, Wu J, Ito Y, Karasawa W, Shibata M, Kanamori H, et al. End sequencing and chromosomal in silico mapping of BAC clones derived from an indica rice cultivar, Kasalath. Breed Sci. 2004;54:273–9.View ArticleGoogle Scholar
  12. Kurata N, Nagamura Y, Yamamoto K, Harushima Y, Sue N, Wu J, et al. A 300 kilobase interval genetic map of rice including 883 expressed sequences. Nat Genet. 1994;8:365–72.PubMedView ArticleGoogle Scholar
  13. McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, et al. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res. 2002;9:199–207.PubMedView ArticleGoogle Scholar
  14. McCouch SR. Gene nomenclature system for rice. Rice. 2008;1:72–84.View ArticleGoogle Scholar
  15. Neff MM, Turk E, Kalishman M. Web-based primer design for single nucleotide polymorphism analysis. Trends Genet. 2002;18:613–5.PubMedView ArticleGoogle Scholar
  16. Ogawa T, Yamamoto T, Khush GS, Mew T-W. Breeding of near-isogenic lines of rice with single genes for resistance to bacterial blight pathogen (Xanthomonas campestris pv. oryzae). Jpn J Breed. 1991;41:523–9.View ArticleGoogle Scholar
  17. Oka HI. Phylogenetic differentiation of cultivated rice. XV. Complementary lethal genes in rice. Jpn J Genet. 1957;32:83–7.View ArticleGoogle Scholar
  18. Ouyang S, Zhu W, Hamilton J, Lin H, Campbell M, Childs K, et al. The TIGR rice genome annotation resource: improvements and new features. Nucleic Acid Res. 2007;35:D883–7.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Rice Annotation Project. The rice annotation project database (RAP-DB): 2008 update. Nucleic Acid Res. 2008;36:D1028–33.PubMed CentralView ArticleGoogle Scholar
  20. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa: Humana; 2000. p. 365–86.Google Scholar
  21. Saito T, Ichitani K, Suzuki T, Marubashi W, Kuboyama T. Developmental observation and high temperature rescue from hybrid weakness in a cross between Japanese rice cultivars and Peruvian rice cultivar ‘Jamaica’. Breed Sci. 2007;57:281–8.View ArticleGoogle Scholar
  22. Sakata K, Nagamura Y, Numa H, Antonio B-A, Nagasaki H, Idonuma A, et al. RiceGAAS: an automated annotation system and database for rice genome sequence. Nucleic Acid Res. 2002;30:98–102.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Sardesai N, Kumar A, Rajyashri KR, Nair S, Mohan M. Identification and mapping of an AFLP marker linked to Gm7, a gall midge resistance gene and its conversion to a SCAR marker for its utility in marker aided selection in rice. Theor Appl Genet. 2002;105:691–8.PubMedView ArticleGoogle Scholar
  24. Sato YI, Hayashi K. Distribution of the complementary genes causing F1 weakness in the common rice and its wild relatives. 1. L-2-a gene in Asian native cultivars. Jpn J Genet. 1983;58:411–8.View ArticleGoogle Scholar
  25. Sato YI, Morishima H. Studies on the distribution of the complementary genes causing F1 weakness in the common rice and its wild relatives. 2. Distribution of two complementary genes, Hwc1 and Hwc2 gene in native cultivars and its wild relatives of tropical Asia. Euphytica. 1987;36:425–31.View ArticleGoogle Scholar
  26. Sato YI, Morishima H. Distribution of the genes causing F2 chlorosis in rice cultivars of the Indica and Japonica types. Theor Appl Genet. 1988;75:723–7.View ArticleGoogle Scholar
  27. Sato YI. Mode of inheritance of inviability. In: Matsuo T, Futsuhara Y, Yamaguchi H, editors. Science of the rice plant, 3, genetics. Tokyo: Food and Agriculture Policy Research Center; 1997. p. 344–8.Google Scholar
  28. Shi Y, Lan F, Matson C, Mulligan P, Whetstine JR, Cole PA, et al. Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell. 2004;119:941–53.PubMedView ArticleGoogle Scholar
  29. Shii CT, Mok MC, Temple SR, Mok DWS. Expression of developmental abnormalities of Phaseolus vulgaris L. Interaction between temperature and allelic dosage. J Hered. 1980;71:219–22.Google Scholar
  30. Terashima T, Fukuoka S, Saka N, Kudo S. Mapping of a blast field resistance gene Pi39(t) of elite rice strain Chubu 111. Plant Breed. 2008;127:485–9.View ArticleGoogle Scholar
  31. The Rice Full-Length cDNA Consortium. Collection, mapping, and annotation of over 28, 000 cDNA clones from japonica rice. Science. 2003;301:376–9.View ArticleGoogle Scholar
  32. Thorpe KL, Abdulla S, Kaufman J, Trowsdale J, Beck S. Phylogeny and structure of the RING3 gene. Immunogenetics. 1996;44:391–6.PubMedView ArticleGoogle Scholar
  33. Xu X, Chen H, Fujimura T, Kawasaki S. Fine mapping of a strong QTL of field resistance against rice blast, Pikahei-1(t), from upland rice Kahei, utilizing a novel resistance evaluation system in the greenhouse. Theor Appl Genet. 2008;117:997–1008.PubMedView ArticleGoogle Scholar
  34. Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang Z-X, Kono I, et al. Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci USA. 1998;95:1663–8.PubMedPubMed CentralView ArticleGoogle Scholar
  35. Yu J, et al. A draft sequence of the rice genome (Oryza sativa L. spp. indica). Science. 2002;296:79–92.PubMedView ArticleGoogle Scholar

Copyright

© Springer Science + Business Media, LLC 2009